Q: 11. Blood type is controlled by a gene with multiple alleles. A produces type A blood. B codes…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Angiostrongyliasis cantonesis, the organism that cause Rat Lungworm Disease, is a
A: Answer: A parasitic organism is an organism which lives on or in other host organisms or get their…
Q: The proton channel of ATP synthase consists of: 8–14 pairs of α helices. 8–14 a subunits. 7 α…
A: 8-14 a subunits ADP and phosphate are converted into ATP by the mitochondrial enzyme ATP synthase,…
Q: If an organism grows as a mold at lower temperatures and grows as a yeast at higher temperat this…
A: Introduction: Mold or mould is the structures of certain fungi can form. Yeasts are single-celled,…
Q: Huntington’s disease is a degenerative disease of the nervous system that strikes in middle age. The…
A: Huntington's disease follows autosomal dominant pattern meaning only single allele is required to…
Q: The features of the garden pea that made it a basic principles of inheritance •good organism for…
A: Mendel's core theories of heredity made it easier to comprehend how features are passed down from…
Q: Which of the following is a component of humoral immunity? O Na Natural Killer cells B lymphocytes…
A: Immunity is the body's ability to protect itself from foreign cells that enter the body and can be…
Q: Two most common causes of infant meningitis are Streptococcus pneumoniae and Haemophilus influenzae.…
A: Streptococcus pneumoniae is a gram positive bacteria.This bacteria is responsible for pneumonia…
Q: In radishes long radish L is dominant over short radish. A farmer cross pollinates a long radish…
A: Introduction The relationship between two variants of a gene is described as dominant. Each gene…
Q: We want to extract DNA from this culture of bacteria suspended in Media the bacteria cells are…
A: DNA extraction is the process of isolating DNA from the cells it is found in. In order to do this,…
Q: Compare exons and introns. What are their significance and role in the genome organization of…
A: Introduction :- A gene's exon is a coding region that houses the data needed to produce a protein.…
Q: Instructions: Enter the number in the box that matches the crosses with the genotypic and phenotypic…
A: A dominant allele, that can inherit from either of the parent, causes a dominant phenotype in those…
Q: A woman diagnosed with early-onset Alzheimer's due to a mutation of the APP genehas children with a…
A: Azheimer's disease (AD) is a neurodegenerative disorder characterized by progressive dementia and…
Q: Which of the following does not contribute to preserving the memory of identity in a dividing cell?
A: It is important for a dividing cell to preserve its identity so that it can be correctly…
Q: Which of the following proteins preserves an epigenetic alteration of DNA? O MYOD O Ey O HAT…
A: Introduction Epigenetics is the study of how changes in your environment and behaviour can have an…
Q: The beach mouse (Peromyscus polionotus) is a small rodent found in the southeastern United States.…
A: Introduction An organism's genotype is made up of all of its genetic components. The alleles or…
Q: For the symbiotic relationship between termites and protozoa - the termite provides a favorable…
A: There are different type of relationship between microbes and others parasites or animals that can…
Q: a. b. What is the basic principle of image formation using this microscopy technique? What can be…
A: Introduction Light microscopy involves using a light source to illuminate the specimen. The light…
Q: From the list below identify the most suitable software used to visualize a change in amino acid on…
A: Understanding the relationship between the protein sequence and its structure helps us to find the…
Q: 17-19. A man and women of normal phenotype have a son with Duchenne muscular dystrophy, a sex-linked…
A: The correct option is (c) A=1/2 OR 50%,B=0%,C=1/4 OR 25%
Q: The gel image below shows 7 alleles, let's call them 1-7 in order of size, with 1 being the largest…
A: In agarose gel electrophoresis, DNA fragments are separated according to their size (or the number…
Q: In a study of coat colour in beach mice, researchers measured the darkness of the fur on the backs…
A: (Change)Here the relation of offspring phenotypes is studied on the basis of mid parent value i.e.…
Q: In the biotechnology industry, lysine is produced by fermentation using which of the following?…
A: Lysine is a alpha amino type of amino acid which is precursor for many proteins. It contain alpha…
Q: 2.Once ovulution occurs. the corpus luteum.... which of the following contributes the function of…
A: Introduction The female reproductive system's uterus and ovaries undergo a series of physiological…
Q: vehicle transmission
A: person can get cholera by drinking water or eating food contaminated with the cholera bacterium.…
Q: Which of the following is capable of phagocytosis? Basophils Antibiodies Lymphocytes Macrophages
A: Phagocytes are cells that protect the body by ingesting any harmful foreign particles or bacteria.
Q: 9-10. In watermelons, the genes for green color and short shape are dominant over their alleles for…
A: A dihybrid cross is a cross between two people who have two observed traits that are controlled by…
Q: Name of virus Papilloma viruses RNA or DNA Double stranded (ds) or Single Stranded (ss) Linear or…
A: Papilloma virus More complex natured virus. Non enveloped. Contain DNA 10% and protein 90%.…
Q: Complete the following statements about the purpose of meiosis, autosomes, and sex chromosomes. Not…
A: In organisms that reproduce sexually, meiosis is a unique form of cell division of germ cells which…
Q: Refer to the following illustration to answer the questic The illustration shows: O a lysogenic…
A: The transposable genetic element also named as mobile genetic element or jumping genes. They can be…
Q: 20-21. If the litter resulting from the mationg of 2 short-tailed cats contains 3 kittens without…
A: 20-21. If the litter resulting from the mationg of 2 short-tailed cats contains 3 kittens without…
Q: Please explain briefly why the use of DNA analyses for identification of plant species is still in…
A: Disclaimer: - Please repost the question as it contains multiple questions and according to the…
Q: Find out how a gene from a bacterial genome is transferred into a plasmid within the same cell.
A: The asexual process of bacterial proliferation is called binary fission. The bacteria split in two,…
Q: 5. A tall coconut tree is crossed with a dwarf coconut tree, producing offspring that are neither…
A: Introduction Genetics is frequently used to refer to heredity, which is the passing on of genetic…
Q: For growth, a mutant bacterium requires that an amino acid not required by the wild parental strain…
A: Answer :- For growth, a mutant bacterium requires that an amino acid not required by the wild…
Q: Compare the nitrogen and phosphorous cycles. How are they similar? How are the different? How does…
A: As per our company guideline we are supposed to answer only first question. Kindly repost other…
Q: Although the RBS (Ribosome-Binding Site) sequences vary considerably in different genes, they…
A: A ribosome binding site (RBS) is a sequence of nucleotides located upstream of the start codon of an…
Q: 1. Gastric juice has a H+ concentration of 10-3 M. What is the pH of gastric juice? 3 2. The pH of…
A: Introduction : pH is a numeric scale in chemistry that is used to determine whether the substance…
Q: In the ABO blood group system, what phenotype(s) could the offspring have if the parents' genotypes…
A: The ABO blood group system is made up of four blood groups: A, B, AB, and O. It is based on antigens…
Q: Please explain and give an example of pleiotropy
A: Gene interaction is a set of functional association between genes. Gene interactions occur when two…
Q: Is there a specific time of day the O&P should be completed?
A: In an ova and parasites (O&P) test, a specialist sees an example of stool under a magnifying…
Q: The following questions are based upon viewing a sample (the letter “e”) under a microscope with…
A: A series of fundamental physical factors limit the resolution of all-optical microscopes, including…
Q: Fluorescence confocal microscopy (FCM) - STK38 monoclonal antibody (M01), clone 2G8- 1F3. 200 μm a.…
A: The STK38 Monoclonal Antibody from LifeSpan BioSciences is a Mouse Monoclonal antibody. This…
Q: 10. Effective population size refers to the number of individuals which can participate in the…
A:
Q: 7-8. Assume that white color is dominant over yellow color in squash. If pollen from the anthers of…
A:
Q: Which of the following is NOT part of the body's third line of defense? Cytotoxic T-lymphocytes…
A: Introduction Basically, 3 types of line of defense are found in our body :- Physical and Chemical…
Q: The procedure to find the mechanism through which bacterial genetic material may withstand…
A: Small, microscopic organisms known as microorganisms are found almost everywhere. They are found in…
Q: Penicillin does not directly kill bacteria. Why do cells usually die in the presence of penicillin?…
A: Gram positive and Gram Negative bacteria are the populations of different kinds of bacteria that…
Q: Determine if the following statement is true or false. "Parents with the dominant phenotype cannot…
A: A dominant phenotype refers to a trait which is expressed in one of two conditions: the inheritance…
Q: Which of the following rows indicates this pregnancy hormone and the correct location of production?…
A: Introduction Pregnancy is an event in which the fertilised egg cell starts developing into an embryo…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:biotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis. Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
- HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
- HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?Sequence of which of the following cannot be determined using the Maxam Gilbert method?a) Bacteriab) Plantsc) Bacteriophage T7d) PlasmidPlease answer the following using the experiment data below. Provide the formulas or methods used for calculations of each. Number of colonies on LB/amp/ara plate = Micrograms of DNA spread on the plates = Transformation efficiency = DNA plasmid concentration: 0.08 μg/μl 250 μl CaCl transformation solution 10 μl pGLO plasmid solution 250 μl LB broth 100 μl cells spread on agar 227 colonies of transformants
- profile-image If you take a DNA photolyase- strain of E. coli, and subject it to the treatment below step 1, spread evenly on LB plate step 2, subject to UV light step 3, cover half of plate and grow in light What will be the most likely outcome if the level of UV is nearly lethal to cells on the plate? a. Only colonies on uncovered side of plate b. Only colonies on covered side of plate c. very few colonies in roughly equal numbers on both sides of plateWhat conditions are making bacteria competent to taking up a foreign plasmid? Please answer asapConjugation using ________ will result in the transmission of a segment of chromosomal DNAfrom one host to another using a plasmid. Question 25 options: F‑strain High frequency recombination (hfr) strain F+strain F plasmid F' plasmid