Complete the sentences below using the words and phrases on the left. Then arrange the text boxes to show the order of key events n prokaryotic transcription. (Each word or phrase is used only once, and not all of them are used.) Drag the text blocks below into their correct order. origin After binding to the promoter, RNA polymerase unwinds part of the , exposing the template strand and forming an hairpin loop hydrogen bond The terminator sequence in the that may form a , signals the RNA polymerase to stop transcribing. transcribed mRNA 5' end of the MRNA The is released, marking the end of initiation. 3' end of the MRNA transcription bubble In elongation, RNA polymerase continues to unwind the DNA and add to the growing mRNA chain in a moving region called the promoter Initiation begins when RNA polymerase, with a o (sigma) subunit associated, recognizes and binds to the DNA double helix region of DNA forming a o subunit

Complete the sentences below using the words and phrases on the left. Then arrange the text boxes to show the order of key events n prokaryotic transcription. (Each word or phrase is used only once, and not all of them are used.) Drag the text blocks below into their correct order. origin After binding to the promoter, RNA polymerase unwinds part of the , exposing the template strand and forming an hairpin loop hydrogen bond The terminator sequence in the that may form a , signals the RNA polymerase to stop transcribing. transcribed mRNA 5' end of the MRNA The is released, marking the end of initiation. 3' end of the MRNA transcription bubble In elongation, RNA polymerase continues to unwind the DNA and add to the growing mRNA chain in a moving region called the promoter Initiation begins when RNA polymerase, with a o (sigma) subunit associated, recognizes and binds to the DNA double helix region of DNA forming a o subunit

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
A) Describe each step of the DNA REPLICATION in EUKARYOTIC organismsB) Describe each step of the TRANSCRIPTION in EUKARYOTIC organisms.C) Describe each step of the TRANSLATION. Please answer all if you can! thank you
The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which is the template strand (top or bottom)? Possible Answers: A. Top - Where the TATA box is found B. Bottom - Opposite where the TATA box is found C. Bottom - Where the holoenzyme RNA polymerase attaches to the promoter D. Top - Opposite of where the holoenzyme RNA polymerase attaches to the promoter
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post-transcriptional processing. Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference. DNA strand: 5'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-3 'Complementary strand: 3'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-5'
Define the following terms: a. Okazaki fragment b. ter region c. tus protein d. transcription preinitiation complex e. ORC
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcript
Please answer asap and in short and content should not be palgarised please For each of the following RNA molecules: Indicate if it is Required or Not for translation in prokaryotes and, if it is required, what does it do? mRNA tRNA rRNA snRNA
Give 7 examples where a specific nucleotide sequences/elements are recognized by protein or protein/RNA complex, from lecture 3.1-3.6. at least one examples from prokaryotic transcription, eukaryotic transcription, RNA processing, RNA stability, translation respectively. For each example, list the specific DNA/RNA sequences/elements and the protein or complex. E.g. eukaryotic promoter, transcription factor, transcription initiation.
Use the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?