Q: Purple (P) flower color is dominant to white (p) flower color. A cross between a purple plant and a…
A: A trait is a characteristic feature that is unique to particular individual. Each trait is…
Q: 29. Given the DNA sequence, please write the mRNA and then amino acid sequence.…
A: Amino acids are the organic compounds that contain both amino and carboxylic acid as their…
Q: Macmillan Learning There are many examples of species that were ancestral to or closely related to…
A: Australopithecus afarensis existed between 3.9 to 2.9 million years ago(mya). So, the first blank…
Q: Food Sample 2 (Unknown) Benedict's test Green precipitate A. reducing sugars not presnt B.…
A: Introduction Carbohydrates are the biomolecules acts as a main energy source in all living…
Q: roblem 1 a) State the different requirements for a disinfectants b) State the advantages and…
A: Disinfection is process of the application of a chemical agent to destroy or inhibit the growth of…
Q: what ways to modify food and kcal intakes to achieve beneficial physiological changes
A: Beneficial physiological changes : Physiological changes in day-to-day life and activities that can…
Q: Describe the P pathway from retina to higher visual processing areas. What type of visual…
A: The term "visual pathway" refers to the anatomical elements in charge of turning light energy into…
Q: EVOLUTION LINK The reactions of glycolysis are identical in all organisms-prokaryotes, protists,…
A: Metabolic processes is a type of chemical reaction in which complex molecules are converted to…
Q: DNAT A C C G C C C C A T G A T G A A T A C C…
A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…
Q: Consider the following scenario: Molecule X is highly concentrated outside of a cell membrane.…
A: The transportation of molecules across the plasma membrane depends on their concentration gradient…
Q: The Baltimore Orioles and Black-backed Orioles species complex has conflicting evidence in support…
A: The Baltimore Oriole and the Black-backed Oriole may be sister taxa, according to a recent…
Q: a. Briefly describe the pharmacokinetics of inhaled nicotine. Would you expect pharmacokinetics of…
A: Nicotine is a naturally produced alkaloid in the nightshade family of the plants . It is widely used…
Q: When considering the limitations of external respiration, explain why animals larger than flatworms…
A: Air is moved through the conducting tubes between the atmosphere and the lungs during ventilation,…
Q: Mutagenesis is a technique in which genetic information of an organism is altered in a stable manner…
A: There are a few important points : Mutation: A sudden and heritable change in the sequence of the…
Q: Write a brief note on ethical usage of animal in pharmacological research? Please answer at your…
A: Animals are used in research to develop medicines and treatment techniques to address illnesses. As…
Q: Soluble free radicals often lead to disease by binding to tissues. So which of the following…
A: Answer : c ) Type III Reason : An improper or excessive immune response to an antigen that has…
Q: At the very end of cellular respiration (glycolysis followed by pyruvate oxidation, the citric acid…
A: Cellular respiration is the process by which energy is produced by the breakdown of glucose. In…
Q: Question 4a-d: H9 IMR90 AT ال ... DMRS Gene Chr10 a. Name one method that could have been used to…
A: DNA methylation is a heritable epigenetic mark that involves DNA methyltransferases covalently…
Q: Among the following statements regarding the use of viral vectors, which is (are) true: (can be more…
A: Transfer of foreign nucleic acid insert into the eukaryotic cell is transfection. For many…
Q: Autodock, Gold and Glide are other bioinformatics tools that are widely utilized by many researchers…
A: A technique called molecular docking examines how molecules are oriented and conformed within a…
Q: What is a Ranvier knot? A.Region that closes on a GFP, when calmodulin and M13 interact in the…
A: Generation and transmission of nerve impulse is the characteristics of neurons that are the main…
Q: WHO is Henry Lowe ? what what did he created?
A: Dr Henry Lowe was born on April 9, 1939. He is a scientist and businessman in the health industry.…
Q: glucagon is synthesized and secreted from the α-cells of the pancreas. Please describe how glucagon…
A: After the meals or in between the meals blood glucose levels tends to fall because of the continued…
Q: What are the functional differences between on-center ganglion and off-center ganglion cells?
A: Introduction :- The retina's main output cells are ganglion cells. At the optic disc, where their…
Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…
A:
Q: A B cat frame-shift no cat no cat cat nonsense cat C % survival 120 100 80 60 40 20 0 42 cat cats…
A: Fig 4: Panel A- Technique: Fluorescence microscopy has been used. All the 4 strains are grown on in…
Q: Agricultural runoff is a major source of pesticide and excess nutrient pollution. This is a…
A: 1) As agricultural runoff moves, gathers up, and carries away both natural and man-made pollutants,…
Q: What is sonication? Why do we sonicate that sample?
A: Sonication is the process in which sound waves will be used for cell lysis to disrupt them. * These…
Q: Describe the stages of meiosis.
A: Introduction Meiosis is a unique form of germ cell division that creates gametes, such as sperm or…
Q: If a trained runner performed a VO2 max test on the treadmill on one day and then did a VO2 max test…
A: Answer The VO2 max numbers would be almost the same, but there is a probability that the VO2 during…
Q: 2. In fruit flies: At the b locus, + = normal color b = black body At the v locus, + = normal wing v…
A: An individual expressing a dominant trait could have two copies of the dominant allele (homozygous…
Q: Explain how sequences within the RNA determine where splicing occurs.
A: Transcription is a process that converts DNA into mRNA in the nucleus. *Mature mRNA will be…
Q: About how many carbon (14) beta decays occur in your body every minute?
A: Carbon 14 has a half life about 5730 years where it is reached at its 50%. 8 thousands atoms decay…
Q: Genetically modified foods (GM foods) are products produced from organisms that have had genetic…
A: Crops that have had their DNA altered through genetic engineering are referred to as genetically…
Q: How many ATPs are there in this triglyceride? Showing NADH and FADH2 calculations and steps
A: Triglycerides broken down into glycerol and three fatty acids containing 12, 16 and 14 carbon atom…
Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…
A: Introduction : Angiosperms are flowering plants that produce fruits with seeds inside of them. They…
Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG
A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…
Q: Determine how screening is carried out if pCR®II-TOPO® is used for cloning?
A: There are many applications of PCR as used in DNA fingerprinting to identify an individual from…
Q: (ii) Is the sequence below in FASTA format? Justify your answer. >gi 129295|sp|P01013 | OVAX_CHICK…
A: Sequence alignment is a procedure in bioinformatics where DNA, RNA, and protein sequences are…
Q: All of the following are beneficial for a pathogenic bacterium, but, O adhesins O fructose O…
A: The bacteria are responsible for causing different disease (pathogenesis) in humans, animals and…
Q: how to do a qualitative anatomical analysis of the ankle in a squat
A: 1. Quadriceps femoris muscles- it joins the femur and lower hip to the tibia and knee joint. 2.…
Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…
A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…
Q: Include some background on ethanol fermentation (i.e. biochemistry, factors that affect…
A: Yeast is a single-celled fungus that most likely developed from a multicelled progenitor and…
Q: On the diagram below, i) draw where the uncoupling protein must be located and ii) indicate the…
A: Electron transport chain: A series of protein complexes that are generally found in the outer wall…
Q: Some organisms thrive at pH 2; other organisms thrive at 65°C. Yet mammals cannot tolerate either…
A: Protein structures are produced by the condensing of amino acids into peptide bonds. The arrangement…
Q: what are the downsides of homologous recombination?
A: Ans: Homologous recombination is the exchange of genetic information between the two identical…
Q: At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous…
A: Answer : Due to the resonance nature of the purine and pyrimidine bases, nucleic acid strongly…
Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…
A: Many people agree that one of the 20th century's most significant contributions to molecular biology…
Q: The chemical analysis of a saliva of the patient has revealed decrease of concentration of potassium…
A: Introduction Acini, which is a rounded secretory unit, and ducts make up salivary glands. Serous…
Q: Which of the following processes determines the arrangement of organs and tissues in their…
A:
convert 120000 nanogram/minute to mg/day
Step by step
Solved in 3 steps
- Your patient drank the following liquids for breakfast: 220 ml of orange juice, 180 ml of milk and 150 ml of coffee. How many milliliters of liquid did your patient drink. Given that there are 16 ounces in a pint, convert a rate of 36 pints per hour to ounces per minute. show workCalculate the mass of a liquid with a density of 3.2 g/mL and a volume of 25 mL
