D e f g h 31II3:1 Normal 1 No Spac. Heading 1 Heading 2TitleSubta田,、三三三三ParagraphStyles43.6.1.3. Shown here is the structure of a human gene.exons= intronsTranscription terminationsite (also poly A site)PromoterStart ofm2transcription5-ATGTAA130132ATT222TAC065'a. What is the length of the primary mRNA transcript (before splicing)?b. What is the length of the mRNA after splicingC. How many amino acids will this protein have?d. Where would you find a mutation that affects transcription of this gene?e. Where would you find a mutation that affects splicing?f. What effect would the mutation m2 have on pre-mRNA?g. What effect would mutation m2 have on the length of the mature mRNA?h. What effect would mutation M2 have on the protein produced?F5F6F8F10F11F12F7&7.

A human gene at molecular level consists of several parts like promoter where the transcription…

Answered: d. Where would you find a mutation that…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Similar questions

28. Approximately 50 % of the human genome is composed of a. protein-coding genes b. ribosomal RNA genes c. mobile genetic elements like transposons and retrotransposons d. introns e. promoter sequences.
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
About 95% of the average human transcription unit consists of: a. short repeat sequences. b. protein-coding sequences. c. regulatory sequences. d. introns. e. origins of replication.
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
What transcripts will be most affected by low levels of a-amanitin? 18S and 28S rRNAs pre-m RNAs 5S rRNAs and tRNAs other small nuclear RNAs
6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAGCTTAC
Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible nucleotide sequence in the template strand of the gene that codes for met-enkephalin, assuming that every base of the gene is transcribed and then translated?
3. Jacques Monod, one of the geneticists who won the NobelPrize in medicine for deciphering the regulatory control of thelac operon, famously stated:“All that is true for E. coli, is true for the elephant.” • In 2-3 sentences, provide a rationale for why Monod’sstatement accurately reflects fundamental shared featuresof gene regulatory control in common between prokaryotesand eukaryotes. • In an additional 2-3 sentences, provide a critical analysisthat describes in detail AT LEAST TWO of the keydifferences between prokaryotes and eukaryotes in howthey regulate their genes.
8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?
40The accepted term for the functional investigation of a gene that starts with the gene sequence rather than a mutant phenotype is forward genetics. Yesorno 41Alu elements in the human genomes are examples of SINE elements. Yesorno 42The lac operon has three lac operators. Yesorno
Diamond–Blackfan anemia (DBA) is a rare, dominantgenetic disorder characterized by bone marrow malfunction,birth defects, and a predisposition to certaincancers. Infants with DBA usually develop anemia in the firstyear of life, have lower than normal production of red blood cellsin their bone marrow, and have a high risk of developing leukemiaand bone cancer. At the molecular level, DBA is causedby mutations in any one of 10 genes that encode ribosomalproteins. The first-line therapy for DBA is steroid treatment,but more than half of affected children develop resistance tothe drugs and in these cases, treatment is halted. DBA can betreated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers.Transplants from unrelated donors have significant levels ofcomplications and mortality. While a stem cell transplant from an unaffected donor is currentlythe only cure for DBA, genome-editing technologies mayone day enable the correction of…

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS