Gene A Gene B Gene C Low levels of gene A transcription generates some transcripts of the gene. | No transcription of gene B leads to no synthesis of protein B. Continuous transcription of gene C generates many transcripts of the gene. Translation of each of the gene A transcripts generates some protein A. Translation of each of the gene C transcripts generates many molecules of protein C. FIGURE 7.4 The Level of Gene Expression Can Be Controlled ? How does the fact that MRNA is quickly degraded help a cell control gene expression?

Gene A Gene B Gene C Low levels of gene A transcription generates some transcripts of the gene. | No transcription of gene B leads to no synthesis of protein B. Continuous transcription of gene C generates many transcripts of the gene. Translation of each of the gene A transcripts generates some protein A. Translation of each of the gene C transcripts generates many molecules of protein C. FIGURE 7.4 The Level of Gene Expression Can Be Controlled ? How does the fact that MRNA is quickly degraded help a cell control gene expression?

Name: How does the fact that mRNA is quickly degraded help a cell control ge
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: How does the fact that mRNA is quickly degraded help a cell control gene expression? Gene AGene BGene CLow levels of gene Atranscription generatessome transcripts ofthe gene.|No transcription of gene Bleads to no synthesis ofprotein B.Continuous tran

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that it encodes is only found in afew specific regions?
Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?
I've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?
The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?
You have isolated a protein that binds to DNA in theregion upstream of the promoter sequence of the sysgene. If this protein is a positive regulator, which ofthe following would be true?a. Loss-of-function mutations in the gene encodingthe DNA-binding protein would cause constitutiveexpression of sys.b. Loss-of-function mutations in the gene encodingthe DNA-binding protein would result in little orno expression of sys.
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockouts
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b