Q: The kidney is a target of several complicated pathways, but the effects can be summarized as the…
A: Introduction: Two bean-shaped organs, the kidneys are each roughly the size of a fist. One is on…
Q: Write 5 strategies to make classroom and play ground healthy, safe and active spaces.
A: Introduction Being in the 21st century it is important for making the students ready for future…
Q: Rank the relative size of the gametophyte generation in the following plant lineages: Bryophyte…
A: Plants show alternation of generation where they complete their life cycle in two phases - a diploid…
Q: Consider a locus with two alleles (b1 and b2) in a population of bacteria (bacteria are haploid).…
A: The Hardy-Weinberg principle is also known as the Hardy-Weinberg equilibrium or law in population…
Q: 1. Determine the inactivation rate constant (K) for a microorganism for the following treated…
A: The inactivation of microorganisms in a disinfection plant is determined by the length of time the…
Q: What are the functions of saliva?
A: Saliva is a clear liquid secreted by the salivary glands present in the mouth region. The saliva…
Q: 1. The antibacterial activity of flavonoids was tested against the bacterial strain, Escherichia…
A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: Which coenzyme is not a Pyruvate Dehydrogenase Complex (PDH) requirement? O a. thiamine…
A: Introduction Coenzymes are non-proteinaceous substances that are essential for enzymes and increase…
Q: Are the Sweet potato and Potato homologous or analogous? What type of evolution has brought such a…
A: Introduction : In biology, evolution is the alteration in a species' traits over a number of…
Q: Which of the following is NOT true of stabilising selection a. it occurs when inidivuals with…
A: Introduction EVOLUTION : The series of events that occurs from the generations to generations for…
Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…
A: Vitamins are essential constituents of food other than carbohydrates proteins and fats required in…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…
A: Luteinizing hormone (LH) and follicular stimulating hormone (FSH) are released from the anterior…
Q: What vaccines are available to prevent viral hepatitis?
A: Introduction Hepatitis virus as the name suggests affects the liver, Hepatocytes, and itis means…
Q: Select your "favorite" bone in the human body or one you find interesting and then identify whether…
A: The skeleton system in an adult body is made up of 206 individual bonds. The endoskeleton is…
Q: By what mode of cell division would you expect sperm cells to be formed in the haploid male bee?…
A: Cell division occurs when a parent cell divides into two or more daughter cells. Cell division is…
Q: In some organisms, asexual reproduction can occur from just a fragment of the parent organism,…
A: Asexual reproduction is a type of reproduction in which new offsprings are produced from a single…
Q: The following diagram shows two pairs of homologous chromosomes. One pair of homologous chromosomes…
A: The sexually reproducing organisms produce gammates that are the unit of sexual reproduction. The…
Q: Can you show me the cross and how to get the answers
A: The leaves of the 4-o'clock plant might be green, variegated (white and green), or white. Different…
Q: The light compensation point of a sun leaf is higher or lower than a shade leaf? Higher Lower
A: Light compensation point ( LCP ) LCP is the point on the light curve where the light intensity at…
Q: Julie (a female) has hemophilia. Based on this information, what can we say about the genotypes of…
A: Introduction X-linked diseases are those that occur due to the presence of abnormal/ diseased…
Q: If the line 3 butterflies are crossed with the line 5 butterflies and they produce all extra-long…
A: During the genetic crossing, the parents give rise to their offspring. The offsprings have a…
Q: How many lions do you think there are in 1960 and in 1975?
A: There is continuous drop in lion population and experts estimates that the total population of lions…
Q: Discuss how assortative mating can influence genotype frequencies. Are there any potential…
A: Introduction Assortative mating sometimes referred to as "non-random mating" is a type of sexual…
Q: Sugars starches and cellulose are all types of
A: Macronutrients are nutrients which our body needs in large amounts. These include - carbohydrates,…
Q: A Senecio lautus population growing on a headland has a prostate form, growing low to the ground,…
A: A Senecio lautus is a flowering plant species in the daisy family. The two main populations of this…
Q: if there are 1,000,000 bacteria and 90% of them are killed, how many bacteria remain?
A: Bacterial growth is an orderly increase in the quantity of cellular constituents and number. It…
Q: origin and fate of the progenitor cells of the LGE and which type of migration do these progenitor…
A: LGE or lateral ganglionic eminence along with the MGE or medial ganglionic eminence form the basal…
Q: i. Tabulate the parts and functions of the microscope
A: Introduction A laboratory tool called a microscope is used to examine specimens that are too small…
Q: Lungs contain more elastic fibers than collagen fibers.
A:
Q: Complete the chart below to indicate which occurrences would provide barriers sufficient for…
A: Interbreeding It refers to the breeding of organisms with another organism of different species.…
Q: List the events occur at the neuromuscular junction.
A: Introduction The NMJ or the neuromuscular Junction is the site of synaptic connection between the…
Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence
A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…
Q: identify the following genetic terms in order from smallest to largest. Gene - Nucleotide -…
A: Cell growth and division is mainly regulated by the nucleus of the cell. This nucleus contains…
Q: What is esophageal atresia?
A: Esophageal atresia is a congenital birth defect of the esophagus that is swallowing tube that…
Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…
A: A subfield of biology called cell biology examines the composition, operation, and behavior of…
Q: What are the genotypes of individuals 1, 2, 4, and 7? 9 OLOT 12 10 11 13 14 15
A: This a hungtingtons disease pedigree chart. Because of affected female are present. Using different…
Q: What is the most common cause of liver cancer?
A: A tumour that can develop anywhere in the liver is called liver cancer. On the top right side of…
Q: is a substance secreted by cells in the lungs that reduces surface tension.
A: Lung surfactant is a complex with a unique phospholipid and protein composition. Its specific…
Q: What are the three phases of hepatitis viral infection?
A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…
Q: Why does inflammation occur with contact dermatitis?
A: The clinical definition for skin inflammation is dermatitis (irritation). An allergic or irritating…
Q: What is the effect of aSN oligomers on the vesicles? alo ant video on the PC creen
A: Introduction Alpha-Synuclein(αSN or ASN) is a protein(140 amino acids) expressed in the Central…
Q: Compare herpes zoster and varicella.
A: Herpes zoster is just another name for shingles. The varicella-zoster virus causes both shingles…
Q: Identify a fact about the urinary OR endocrine system (disorder, anatomical structure). Describe…
A: Introduction Glands are a group of cells that produce and secrete enzymes or hormones. Glands are…
Q: a. Make a Venn Diagram to differentiate the exclusive and common organelles in both plant and animal…
A: A subfield of biology called cell biology examines the composition, operation, and behaviour of…
Q: Identify a cardiovascular disorder. Describe that disorder in terms or cause and some typical…
A: According to our guideline we can't mention the sources of the answer. There are different types of…
Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…
A: A subfield of biology called cell biology examines the composition, operation, and behaviour of…
Q: A. Observe the frog ovary and take note of the following structures: theca interna, theca externa…
A: Ovary This is a reproductive hormone where eggs are formed. There are a pair of ovaries present in…
Q: Which statement best describes how diving mammals are different than mammals that are not adapted…
A: Introduction :- Warm-blooded creatures known as mammals have three middle ear bones, sweat glands,…
Q: What is the map distance between the two rapid lysis mutations re and r' given the data below? 2…
A: In the question given that, re- rf- X r+ Large plaques= 5200 Small Plaques= 4800 Out of the total…
Step by step
Solved in 2 steps
