Which of the following is NOT true of stabilising selection a. it occurs when inidivuals with extreme trait values have lower fitness than those with intermediate trait values. b. it keeps the mean close (or moves it closer) to the optimum value c. it can result from opposing directional selection, such as when early flowering makes flowers susceptible to herbivores, but late flowering reduces the availability of pollinators. d. it does not improve the fitness of the population to the environment. e. it decreases the range of variation in the population

Q: Other than bacteria list the other 6 types of Microorganisms listed in your textbook.

A: Microorganisms are defined as the organism that can very smaller in size that they cannot be seen…

Q: Carnivore Herbivores Producers 2gm/m 8 gm/m² 4/gm/m² Inverted Pyramid in an Aquatic Ecosystem

A: Introduction :- Inverted pyramids are pyramids with a wide top and a narrow base.It indicates that…

Q: Explain how and why membrane potential changes during anaction potential

A: Introduction The nerve helps in the transmission of signals from CNS (Central Nervous System) to the…

Q: 1.  Insect blood cells     are hemocites   also carry oxygen   circulate whole body…

A: Insects are hemocoel, in which only tissue fluid and blood are present. The cuticle is present on…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: CRITICAL THINKING QUESTION – NERVOUS SYSTEM Dan, a 50-year-old man, is experiencing muscle stiffness…

A: In the given scenario, Dan is a 50-year-old person suffering from Parkinson's disease. Parkinson's…

Q: identify the following genetic terms in order from smallest to largest. Gene - Nucleotide -…

A: Cell growth and division is mainly regulated by the nucleus of the cell. This nucleus contains…

Q: 3. Match the parts in Column A with its function in Column B. Write the letter on the blank…

A: Introduction The circulatory system is also known as cardiovascular system. The components of…

Q: Molecules that are used for energy, how they feed into aerobic and anaerobic metabolism, which…

A: Metabolism is a sum total of anabolism and catabolism. Anabolism is any activity or reactions that…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: Give three characteristics of enzymes and describe how they permit chemical reactions to occur in…

A: Enzymes are protein molecules except for the ribozyme which is made up of RNA. Proteins are composed…

Q: Name the inorganic substances common in body fluids.

A: Introduction The human body is consisting of around 37 trillion cells in total however a large…

Q: Part III - Trait Analysis 1. The following pedigrees will be used to determine whether the trait is…

A: Pedigree is a family chart showing the Inheritance of a particular trait through several generations…

Q: There is no such thing as truly direct evidence in evolution. Because of the long time spans, we can…

A: Evolution can be defined as a process in which modification of characteristics of organisms takes…

Q: A newly identified bacterium is unable to synthesize ubiquinone. A mobile electron carrier called…

A: Ubiquinone (UQ), also known as coenzyme Q, is a redox-active lipid that plays a role in a variety of…

Q: What is the cause of male gynecomastia?

A: Introduction Hormones play important role in normal physiology in our body. They control various…

Q: 111. Which of the following best describes the relative quantities of the subunits of hemoglobin in…

A: Type of hemoglobin Adult Hb(Hb A)= 2 alpha and 2 beta subunits HbA1 is the major form of Hb in…

Q: Genotype frequencies from two diploid populations are estimated from a genetic marker with two…

A: Genotype frequency refers to the frequency or percentage of a particular genotype in a given…

Q: Name the two functional divisions of the vertebrate nervoussystem, and describe how they interact.

A: Introduction The nervous system is the main controlling center of the body which controls all…

Q: Explain the importance of Document Control and Records Management in the clinical laboratory.  Give…

A: Medical devices can also function as "bridges" (as in cardiac assist, pulmonary assist, and renal…

Q: Can an epidemiologist who finds a correlation between the use of tanning beds and melanoma (an…

A: Introduction Epidemiology is a study that provides information about a health-related concern in a…

Q: Need question 11 answered

A: During gene cloning, the gene of interest or insert is added into the plasmid vector. This is done…

Q: 1. Put the following in the correct order and describe each pattern of disease : period of…

A: The disease is a condition in which normal structure and function of the body are impaired or…

Q: Which of these discoveries were used by paleontologists to conclude that some hominins—Homo erectus,…

A: The species H. erectus is extremely diverse, which is not surprising given its long existence and…

Q: The picture shows the different stages in the life of a pea plant. Which characteristic of living…

A: Introduction  A plant is a living organism of the type represented by trees, shrubs, herbs, grasses,…

Q: Rubisco is present in the Calvin Cycle in C4 photosynthesis True False

A: C4 photosynthesis also called dicarboxylic acid pathway is a mode of photosynthesis found in a…

Q: A high and undesirable divergence between two subpopulations could be resolved through which…

A: First of all let us understand about the topic of divergence and then specifically to the topic to…

Q: A medical imaging facility is considering the purchase of a positron emission tomography (PET) or a…

A: Mutual exclusivity can be defined as a phenomenon in which two things taken into consideration…

Q: 2. Determine whether the event takes place during INHALATION or EXHALATION. _____1. The diaphragm…

A: Inhalation and exhalation are how your body brings in oxygen and gets rid of carbon dioxide.

Q: Will specialist or generalist herbivores tend to evolve resistance to plant toxins? Why?

A: Plans produce secondary metabolites for their difference against herbivores. The chemicals including…

Q: Name the seven parts that is responsible for the Breathing Process . Arrange them in order from…

A: Breathing It is defined as the process of facilitating gas exchange. It brings oxygen gas into the…

Q: Describe two different ways in which ATP is generated in cellular respiration.

A: ATP is a high-energy molecule that acts as the energy currency of the cell. The non-spontaneous…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: Explain the Fundamental Theorem of Natural Selection Fisher

A: R. A. Fisher was a prominent scientist of the twentieth century. He is regarded as the only creator…

Q: In the life cycle of a bryophyte, the sporophyte is nutritionally Dependent or Independent (circl…

A: Introduction Small, non-vascular plants known as bryophytes include mosses, liverworts, and…

Q: Describe the ion concentration gradients across the plasmamembrane of a neuron at resting potential.

A: Introduction Nerves play a vital role in the conduction of signals from CNS to various other organs,…

Q: he Krebs cycle occurs in the Select one:

A: The Krebs cycle or TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle is a sequence of…

Q: The two major patterns proposed by Darwin are: 1) species change over time, and 2) species give rise…

A: Charles Darwin was a British naturalist who proposed the theory of natural selection in biological…

Q: Which of the following is true about the innate immune system? Check all that apply Phagocytosis…

A: Immunity is defined as all of the physiological mechanisms that allow a person's body to recognise…

Q: Straps of dense, regular connective tissue______ . a. connect muscles to bones c. underlie the skin…

A: Introduction  In our body to maintain the proper shape, structure, and integrity of the body,…

Q: A man and his wife are both heterozygous  for brown eyes. They have ix children all of whom have…

A: Genetic Recombination:  The exchange of genetic material between distinct organisms, commonly…

Q: Briefly describe the conditions of protein sample labeling and NMR sample. ?

A: Nuclear magnetic resonance or NMR is used to analyze the structure of a material. It analyzes the…

Q: Complete the chart below to indicate which occurrences would provide barriers sufficient for…

A: Interbreeding It refers to the breeding of organisms with another organism of different species.…

Q: Match the description with the correct term. A. the idea that inherent variation in a population…

A: Evolutionary biology is the science of how evolution happens. Evolution is the mechanism of…

Q: Explain how cells respond to external signals, even when those signals cannot enter the cell.

A: Introduction Cell signaling is the process in which different cells in the body of an organism…

Q: Methods of ATP production –aerobic, anaerobic and other – when are they used, how do they work, how…

A: Most cancer cells undergo aerobic respiration. Cancer cells have significant heterogeneity in…

Q: Cloning of a eukaryotic gene can be carried out in Escherichia coli. However, for the protein…

A: Introduction Eukaryotes are organisms having well-defined cellular organelles that are specified to…

Q: Which of the following would most likely occur if you experimentally depolarise the middle of an…

A: Neuron is a chief structure of nervous system which helps in transfer of impulse from one part to…

Q: Cancers most commonly arise in______ tissue. a. epithelial c. nervous b. muscle d. connective

A: Introduction The tumor is nothing but uncontrolled cell division, which can lead to the formation of…

Q: How does vasodilation reduce the body temperature?

A: Body temperature is maintained by the center present in the form of the hypthalamus. Hypothalamus is…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.