describe  how stress is a  process. Include stimulus, response and process

Q: Sex-linked inheritance

A: Glucose-6-phosphate dehydrogenase deficiency/G6PDD (g) is an X-linked recessive condition.  Fragile ...

Q: Explain Application of palynology in Botany , geology , archeology , criminology, medicine, honey,oi...

A: Palynology is the study of pollen and spores.

Q: Discuss the relative value of broth and agar media in isolating bacteria from mixed.

A: Answer 

Q: How might you be contributing directly or indirectlyto the annual dead zone that forms in the Gulf o...

A: Algae can develop to dangerous levels when there is an overabundance of nitrogen and phosphorus in t...

Q: How did the accidental invention of cheese help Ghengis Khan? (And who is Ghengis Khan?)

A: Genghis Khan's real name was Temüjin. 

Q: two specific functions that polyp structures are used for. For each function, discuss similarities a...

A: Polyp is the body form present in the phylum Cnidaria (Coelenterata) group animals. It is the cylind...

Q: Explain why you are for or against (a) raising theprice of water while providing lower lifeline rate...

A: Introduction Water is a molecule made up of two hydrogen atoms joined by a covalent link to the cent...

Q: and have no 6. Bacteria do not have a a. nucleus, cell membrane b. nucleus, organelles c. cell membr...

A: Answer 6- b. Nucleus, organelle Bacteria do not have a nucleus and have no organelle in them( except...

Q: Assume that a pinhead is 1 mm in diameter. Howmany spherical bacteria (cocci), lined up side by side...

A: spherical bacteria (cocci) are spherical bacteria as their body is round in shape, They may be gram-...

Q: Solutes tend to diffuse from a region where they ar_____ concentrated to an adjacent region where th...

A:

Q: Explain how the three major types of deserts differin their climate and vegetation. Why are desert e...

A: Hi! Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a...

Q: ) Base excision repair requires polymerases. B.) In DNA repair by excision, the non-damaged strand ...

A: Solution : Correct option is d 

Q: Contrast positive versus negative control of gene expression?

A: Introduction :- Gene expression is the process through which information from a gene is used to crea...

Q: What is the key concept for this section? Whatis ecological succession? Distinguish betweenprimary e...

A: Ecology is the study of the interactions between living species, such as humans, and their surroundi...

Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...

A: The coat color of  cat is an X-linked trait. Males are hemizygous (one X chromosome and another Y ch...

Q: Please help explain this LAPTM5 Transport HIV-1 Env to the lysosome for degradation

A: Answer 

Q: What is the number and types of lamprey species that are present in the Great lakes?

A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...

Q: Which statement is correct about the brain of bilingual and multilinguals?

A: The statements about the brain of bilingual and multilingual which hold true are as follows:- The l...

Q: A tree grows and increases its mass. Explain why thisis not a violation of the law of conservation o...

A: Atoms are the smallest things that are designed to be considered as the basic building blocks of the...

Q: Catalase combines two hydrogen peroxide molecules(H2O2 + H2O2) to make two molecules of water. A gas...

A:

Q: 2. During the course of the growth of the soybean, you measured the volumetrie water content of the ...

A: The total volume of water applied during an irrigation event in megalitres (ML) is: the inflow rate ...

Q: To avoid or lessen sunburn while in the aquatic facility, generously apply sunscreen. Reapply every ...

A: The first statement is correct as the generous application of sunscreen avoids and lessens sunburn. ...

Q: Explain your answer. Below is a pedigree showing the inheritance of colorblindness in Akoto family. ...

A: Colour blindness is a color vision deficiency, and a reduced ability of not distinguishing between c...

Q: What is the main cause for ecchymosis around the eye? a. over embalming b. trauma c. under embalm...

A: Ecchymosis is frequently induced by a bump, a blow, or a fall. A blood vessel may break as a result ...

Q: I. Apply your knowledge on the basic structure of amino acids by creating a polypeptide chain that i...

A: The amino acids are the basic structural unit of proteins that contain an alpha carbon which contain...

Q: when viewing an organism under the 40x objective lens, you estimate that 6 organims could fit across...

A: DFV stands for dimension of field of view. You'll need to determine the magnification and field numb...

Q: WHAT ARE THE CONCEPT AND IMPORTANCE OF THE FOLLOWING? I. Translocation through an artificial membran...

A: Osmosis is the spontaneous net movement or diffusion of solvent molecules through a selectively perm...

Q: Describe how the environmental temperature can be measured based on displacement change. Support you...

A: There are few important points: Any undesirable change in the physical ,chemical and biological cha...

Q: Table 2. Starter plate conditions. Starter Plate Bacterial Cas9 DNA Repair System SGRNA Donor Plate ...

A: Q. 

Q: give the Significance  of the ff   Cleavage to embryogenesis       CAMs and Junctional complexe...

A: * cleavage means  division of cells in  embryo . * The cells formes as result of  cleavage are blast...

Q: widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her brother both have a ...

A: Introduction:- A Punnett square is a representation of how different gametes combine to produce dis...

Q: Species Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 Opossum present present present present Platypus present...

A: In the given list of Opossum has all 4 enzymes present. While Platypus miss enzyme 4 and chicken hav...

Q: What are three aspects of your lifestyle that mightdirectly or indirectly contribute to decline in E...

A: Honeybees and many other insects are natural pollinators of a large number of plant species.  

Q: Please help explain this Vpr counteracts the LAPTM5 mediated degradation of HIV-1 Env

A: HIV-1 accessory protein Vpr enhances infection in macrophages but not in CD4+ T cells remains elusiv...

Q: Which letter is correct A. Genetic engineering is preferred because a desired gene to crops may not...

A: There are few points about genetic engineering and conventional farming. Genetic engineering is als...

Q: Are the morphological characteristics of a sponge enough to identify it up to the genus level? Why o...

A: The morphological characteristics of a sponges are used to identify it up to the genus level but mor...

Q: On which bone are the Temporal Lines located? Group of answer choices Frontal Radius Occipital Maxil...

A: Temporal Lines are located in frontal bones and parietal bones.

Q: If at least one dominant allele at two different gene loci, A and B are required for normal hearing,...

A: Dominant genes are those genes whose phenotypes are expressed and recessive genes' phenotypes are su...

Q: 6. Peptide bonds link many amino acids into chains of subunits that make polypeptides, or proteins. ...

A: Peptide bond  Peptide bond is a type of covalent bond present in between two molecules of amino acid...

Q: Help explain this LAPTM5 and LAPTM5 restrict HIV-1 infectivity

A: Answer 

Q: Living Things Mammals Fish aroups? Give birth Lay eggs Can fly Cannot fly Give birth Lay eggs panda ...

A:   INTRODUCTION     Living things are organisms to constitute there life. Living things are mainly s...

Q: Describe the relationship of breathing and respiration, are they the same? Justify your answer.

A:    INTRODUCTION            In living organism breathing and cellular respiration are occurring their...

Q: Explain the process of electron transfer phosphorylation

A: The electron transport chain (ETC) is the final step of aerobic cellular respiration.  

Q: Which of the following statements accurately describes water vapor?   The liquid phase of water is ...

A: Climate change is shifts in weather patterns and temperature. 

Q: Discuss the process of evolution through natural selection. What could happen to the ecosystem and a...

A: Evolution is the most fundamental and organizing principles of the biological sciences and as such i...

Q: Pteridophyta(Fern) Alternation of Generation. What are the structures in the fern plant life cycle t...

A: The fern life cycle requires two generations of plants to complete itself. This is called Alteration...

Q: Which parameter from the software must you adjust in order to permit gene flow? Select One. Startin...

A: Population genetics is study of genetic compositions of populations, with changes in frequencies of ...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is conver...

Q: TACAT

A: Solution :There are three types of DNA Mutations: base substitutions, deletions and insertions. 

Q: 1. You need to lower an injured friend from a building. His injury is located on his chest. Which of...

A: All the given question are provided us as a situation and we have to choose the right method accordi...

Stress

Stress is defined as the feeling of being overwhelmed or unable to cope with emotional or mental pressure. Any event or action that makes a person annoyed, furious, or nervous can trigger it. Chemical changes in the body caused by stress can cause blood pressure, blood sugar levels, and heart rate to rise.