Describe the type and strength of the relationship between number of chicks and predators. positive, curvilinear, weakly correlated positive, linear, strongly correlated negative, linear, weakly correlated O negative, curvilinear, strongly correlated O negative, curvilinear, weakly correlated

Describe the type and strength of the relationship between number of chicks and predators. positive, curvilinear, weakly correlated positive, linear, strongly correlated negative, linear, weakly correlated O negative, curvilinear, strongly correlated O negative, curvilinear, weakly correlated

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter52: Animal Behavior

Section: Chapter Questions

Problem 15TYU

See similar textbooks

Related questions

Q: Which of the following describes the role typical proto-oncogenes have when they are expressed in…

A: Proto-oncogenes, although usually associated with tumors do have a very significant role to play in…

Q: What is the shorthand notation for a fatty acid that contain 20 carbon atoms and double bonds at…

A: Fatty acids are composed of fat in both our body and our meals. The body breaks down lipids into…

Q: When antibiotics and vaccination techniques were first discovered, the statement was made that all…

A: Vaccine can be defined as a non virulent preparation from the antigenic material ,which is able to…

Q: Name: 1. The Excretory system converts dangerous nitrogen-based waste into a. Carbon dioxide b.…

A: Main excretory organs are kidneys. It forms the urine and excretes it out.

Q: neurosurgeon probes a person’s brain to map its functions. The person is awake and feels no pain…

A: Each of the hemispheres in the brain has been divided into four lobes: frontal, parietal, temporal…

Q: How a fish that migrate from freshwater to seawater (and/or vice versa) osmoregulate?

A: Introduction Osmoregulation is a process by which an organism maintain a internal balance between…

Q: The amount and composition of dietary fat are important factors for influencing blood lipid…

A: Dietary fiber can help reduce blood cholesterol levels by: binding cholesterol and bile acids in…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Next Which of the following is true about integral proteins according to the fluid mosaic model?…

A: According to the fluid mosaic model there are different types of proteins within the membrane.…

Q: Two unlinked genes control flower color in snapdragons. You cross a true-breeding yellow flowered…

A: This is a case of recessive epistasis. The rr genotype for R gene is showing epistasis to the W…

Q: How can a UV-Vis spectrophotometer be applicable in determining the absorbance/concentration of a…

A: UV and visible radiation are only a small part of the electromagnetic spectrum, which also includes…

Q: auditory nerve

A: Auditory nerves and the brain Nerve impulses are transmitted from the ear to the brain via the…

Q: 13) when testing the ability of a frog’s skeletal leg muscle to move, which chemical would be best?…

A: Neurotransmitters are chemicals that are responsible for transmitting signals between nerve cells,…

Q: What does the word "patch" denote in a patch-clamp setup? Shape of a glass micropipette Open tip of…

A: Patch clamp technology is a method used in electrophysiology to measure the ionic current. This…

Q: Epiphytes: Epiphytes have adapted to grow without soil in the canopy layer in a tropical rainforest.…

A: Epiphytes are also known as "air plants" because they are not held on to the forest floor. They grow…

Q: How would we explain using examples the non-Mendelian inheritance patterns such as incomplete…

A: Non-Mendelian inheritance It is defined as the inheritance pattern in which the traits are not…

Q: Problem #4 In some plants, having brown seeds (B) is dominant to having white seeds (b). What are…

A: Genotype is the genetic constitution of an individual. Phenotype is the external character of an…

Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…

A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…

Q: You reach for your smartphone and then put it down. You reach for it again but different neurons…

A: Introduction Neurology:- It is a branch of medicine dealing with disorders of the nervous system.

Q: Question 1 Select one answer. Which of the following is not a mechanism used by aldosterone to…

A: Aldosterone is the corticosteroid hormone secreted by the adrenal gland. Plays a major role…

Q: How is the topic about Threats (Biodiversity & Sustainability, Climate Change and Pollution) and…

A: Threats to biodiversity as a example if we take oil spillage during crude oil extraction that used…

Q: Question 46 The monospot test is a rapid latex kit for the screening of [Select] for the presence of…

A: The monospot test looks for 2 antibodies in the blood.

Q: D- Lungs Heart 4 Body organs (a) Name the type of blood vessel labelled (1) C. (ii) D. (b) In which…

A: The heart is a muscular organ about the size of a fist, located just behind and slightly left of the…

Q: 90% Arial 12 C | 1 | 21 3 4 5 6. 7 The list gives some structures in the blood and circulatory…

A: Answer : 1. The structure that can destroy bacteria is : White blood cells. The white blood cells…

Q: Based on the degree of saturation which lipid is a better choice to spread on food, butter or…

A: The 2017 American Health Association Guidelines have given the following insight regarding your…

Q: OC C) D) Osmolality Urine Plasma quency shortly after head trauma. If ADH (vasopressin) deficiency…

A: Introduction: Head trauma : It's called as a any type of damage to the skull or brain and scalp…

Q: A. Cholesterol B. Phosphatidylcholine C. Thioester-linked and acyl anchor D. Phosphatidylinositol E.…

A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. It explains lipid bilayer…

Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughters…

A: The cell division consists of two main steps the division of nucleus and the division of cytoplasm.…

Q: Provide what is being asked for. Show all relevant calculations and summarize your answers in the…

A: Fatty acid oxidation is the aerobic breakdown of a fatty acid into acetyl-CoA units in the…

Q: Jessica was trying to solve a problem given to her in class. Help her figure out which produces more…

A: Excretion is defined as the removal of waste products outside the body. The excretion process is…

Q: ch of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain the…

A: Enhancer is a cis-acting ( on the same gene it controls) DNA regulatory sequence which strongly…

Q: What would happen if all the birds in this activity got sent to an island where no birds had been…

A: Introduction Evolution and variations in beaks of birds, As the theory of Natural Selection,…

Q: Which group of echinoderms has a biradial symmetry and tube feet all over its body?

A: Tube feet is one of the small flexible tubular processes which present in most of the echinoderms…

Q: You decided to change your diet. You want to lose weight without making your physique bulky, which…

A: Weight loss is an internal process that is possible through a healthy diet and by performing intense…

Q: What is the chromosome number of eggs?

A: Chromosome number of eggs is half of the number of chromosomes in the somatic cell. It is by the…

Q: Female cones may be called a(n) _____________________ cone in the Coniferophyta

A: ANSWER;- Female cones may be called a(n) megastrobili cone in the Coniferophyta.

Q: 1) Identify three positions of the patient to obtain a BP. 2) What problems can result from high…

A: One of the most vital components of life is blood. Plasma, blood cells, and platelets make up blood,…

Q: 40. Administration of prednisone for long periods causes atrophy of which of the following endocrine…

A: Prednisone is a glucocorticoid medication mostly used to suppress the immune system and decrease…

Q: a. Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology…

A: As COVID-19 was discovered in Hubei Province, China, in December 2019, COVID-19 has spread…

Q: Which of the following statements regarding Darwin and his theory of evolution is false? Darwin…

A: The theory of natural selection was jointly developed by the charles darwin and the alfred russel…

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: Introduction A base pair is a link between two nitrogenous bases in DNA that helps keep two…

Q: Seeds are produced through the process of______fertilization in order to create ___embryonic plants…

A: Answer :- 1. Double Fertilization 2. Embryo and endosperm.

Q: Rabbit's ears can be either straight (dominant) or floppy (recessive). If a population of rabbits in…

A: Here Hardi Weinberg's principle can be implicated, according to which: p2 + q2 + 2pq =1 p2 ans q2…

Q: HDL is produced via the exogenous lipoprotein pathway? O True O False

A: HDL are the high-density lipoprotein and also called good cholesterol.

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: Body is extremely efficient in the formation of new DNA sequences. Yet there are chances that…

Q: What words below characterizes the amino acids that are found in an alpha-helical segment that spans…

A: The plasma membrane is present in the cell. It is responsible for covering the cell. It provides the…

Q: (a) Name the type of blood vessel labelled (i) C. (ii) D. (b) In which direction does blood in…

A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…

Q: How is the topic about Threats (Biodiversity & Sustainability, Climate Change and Pollution) and…

A: The "Earth" is a massive ecosystem. An "ecosystem" is a group of plants, animals, and other living…

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: To explain: To explain how mismatch repair fixes incorrectly matched base pairs

Q: Question 1 Which of the following lipoproteins is primarily involved in reverse cholesterol…

A: Introduction Reverse cholesterol transport is define as a type of mechanism by which excess of…

Concept explainers

Animal Behavior

Animal behavior can be defined as all the things that animals do. In response to a stimulus, an animal performs a certain fixed action pattern, or FAP, of behavior. This response occurs to make the animal more adaptable to change. So, behavior is generally a stimulus-oriented response. A behavior is an expression of the capabilities of the nervous system. A stimulus is determined by the environment, while the nervous system determines a response.

Question

Suppose that in maroon-fronted parrots, the number of chicks born each year in a population is compared to the number of
predators in the same area.
Correlation coefficient = -0.1
Number of predators
Describe the type and strength of the relationship between number of chicks and predators.
positive, curvilinear, weakly correlated
positive, linear, strongly correlated
negative, linear, weakly correlated
negative, curvilinear, strongly correlated
negative, curvilinear, weakly correlated
Number of parrot chicks

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The type of spatial distribution likely to occur when resources are localized is______ . The type of spatialdistribution that results when pairs of animals defend breeding territories is_______ . The least commonform of distribution is_______ .
If '+' sign is assigned to beneficial interaction, '-' sign to detrimental and '0' sign to neutral interaction, then the population interaction represented by '+' '-' refers to what?
How can we determine whether predation is controlling the size of a population? What are the conditions that promote coexistence between predators and prey? please answer both
In the Lotka-Volterra predator-prey equations, the term a b N prey N predator describes: The rate at which predators eat prey The rate at which new predators are added to the predator population The rate at which the predator population increases over time The intrinsic growth rate of the prey population
Which of the following habitat cues is LEAST likely to factor into how the “landscape of fear and disgust” influences habitat choice? Presence of carcasses High density of conspecific excreta (poop!) Presence of vegetative cover Frequency of territorial singing from conspecific males Bayesian updating can be a useful tool for thinking about the development of behavior. Imagine the following scenario with respect to an animal’s knowledge of the average density of food in patches in their environment. Which of the following is the most accurate interpretation of this Bayesian view of this animal? (shown in image) Their environment is much richer in food resources than expected Their confidence in their assessment of the state of the environment is greater after they go out and sample the world Their environment is less rich than expected – perhaps there is a drought that has caused a crash in food availability relative to historical conditions All of the above
a. Which characteristic found in the prey species is most likely to be advantageous for survival? Why? What environmental factors might influence this? b. Which characteristic was the most successful for each of the predator and the prey populations? What was the selective pressure that allowed this characteristic to be successful? Remember that selective pressures are external factors, either environmental or from a different population. Predator Characteristic: Prey Characteristic: c. For both predator and prey populations, which characteristic was the least successful? What was the selective pressure? Predator Characteristic: Prey Characteristic:
In a population of solitary and independent birds, birds occasionally will build nests close to each other. Females will provision their young with food, but may not have enough for themselves. The bird may try to obtain additional food from their neighbors by visiting their nest. Occasionally the neighbor may share some of its food with the visiting bird. What is necessary for this altruistic behavior to persist in this population and why?
The mark-recapture method is used to estimate the population size of mountain yellow-legged frogs in the San Gabriel Mountains of southern California. 100 frogs are captured and marked. A week later, 50 frogs are captured, and 10 of them are marked. The total population size is
For a population to be mutualistic, the fitness of successful mutualists must be lower than unsuccessful or non-mutualists. True False
What would you conclude after comparing the survivorship of the ground squirrel and the finch? Multiple Choice Both have very large numbers of offspring. Both die primarily of old age. Both suffer high predation throughout the lifespan. They represent different survivorship types.
What is predator management? What is the linkage between the evolution of prey and predator species and how this relates to the regulation of population size? please answer both
The eastern screech owl (Megascops asio) roosts in tree cavities. As long as there are enough tree cavities available for all the owls in the population, the number of tree cavities has no effect on per capita birth or death rates. If there are more owls than the number of tree cavities, the per capita death rate increases with increased population size (because of increased rates of predation or death by exposure). How does this scenario differ from the traditional idea of density-dependent population regulation, as described by Nicholson (1956) or Turchin (1995)? Does it make more or less sense, and why?