Q: What is label #7? (snail shell looking thing) A. Cochlea B. spiral valve C. Vestibule D. Eustachian ...
A: Ear is one od the sense organ that help us in hearing. There are majorly divided into 3 parts, *out...
Q: The eukaryotic cell at left is in the processof cytoplasmic division. Is this cell from aplant or an...
A: Cytoplasmic division is otherwise called as Cytokinesis which separates the original cell, its orga...
Q: 23. On the basis of shape, identify the type of microbes.
A: *In bacteria, the cell wall is a rigid structure with thickness around the cell and it is responsibl...
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: Apes meaning and explanation For much of history, people have used the terms "monkey" and "ape" inte...
Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...
A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...
Q: You are Jeremy’s Biology professor, and he ask you about taking steps to “bulk up”. What would your ...
A: Being a doctor and taking this question as in general category. One should do the followings things ...
Q: Briefly answer the question below: What is the disadvantage of having a really thick smear when stai...
A: Smear:- It is used to fix the bacteria onto the slide and to prevent the sample from being lost duri...
Q: Chromosome All possible chromosome configurations at diakinesis Mutation number wwm Monosomy Trisomy...
A: Aneuploidy occurs due to loss or gain of one or more chromosome.
Q: Which precedes an action potential traveling down the axon of a neuron? A. Neurotransmitters bind to...
A: The right Answer is A
Q: What is thermal death time? What are the factors that may influence the efficiency of chemical growt...
A: Answer 1 :- Thermal death time is the way lengthy it takes to kill a particular bacterium at a parti...
Q: The bald phenotype which is due to a dominant autosomal gene the expression of which is sex influenc...
A: Sex influenced trait are the traits that are controlled by sex chromosome but are exhibited on the a...
Q: The table below summarises the three stages of Meselson and Stahl's experiment and their results. (a...
A: While proposing the double helical structure of DNA Watson and crick had immediately proposed for r...
Q: Much of our understanding of ATP synthase is derived from research on aerobic bacteria. What makes t...
A: ATP synthase is a mitochondrial enzyme that catalyzes the conversion of ADP and inorganic phosphate ...
Q: How is the shape of the bacteria related to it's function?
A: Coccus (spherical), bacillus (rod-shaped), and spiral (twisted) are the three basic bacterial shapes...
Q: List and explain at least 3 Bacterial infections of the skin
A: EXPLANATIONBacterial skin infection: Bacterial skin infections form when bacteria enter through hair...
Q: Photosynthesis is defined as the chemical process, wherein carbon dioxide in the presence of water a...
A: The plants have three basis needs to grow better. These are, 1) Sunlight 2) Water 3) CO2 Along with ...
Q: Simple but creative caption on a poster about noncommunicable diseases caused by having unhealthy li...
A: A non-communicable disease (NCD) is a disease that is not transmitted from one person to another. N...
Q: Give examples to the following questions, then make a cladogram using your answers. 1. Canine (Dog) ...
A: 1. Canines ( dog) A - domestic dog ; B - foxes ; C - wolves 2. Land animals A- Canines ; B- Felis ; ...
Q: Identify the type of flagella from the picture
A: Introduction :- Flagella are the locomotory structures which are present of the cell surface and all...
Q: 14. A previously well 18-year-old girl is admitted to the ICU because of altered mental status. She ...
A:
Q: action of beta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agents on bacterial ce...
A: Microorganisms are killed or slowed by antimicrobial agents. Bacteria, viruses, protozoans, and fung...
Q: Show how data from a two-point test cross can be used to distinguish between independent assortment ...
A: Linkage is the tendency for a pair of genes on the same chromosome to be transmitted down to subsequ...
Q: QUESTION 7 like the flagella of Not all bacteria are motile, but for those who can move, a flagella ...
A: Flagella is a structure present in both prokaryotes and eukaryotes and helps in cell movement. Pleas...
Q: Discuss how the study of microbial biofilms has evolved over time and the contribution of Bill Coste...
A: Biofilm is a term used for defining an association of microbial cells and layer of exopolysaccharide...
Q: Extract from Soursop Leaves Can Prevent the Symptoms of Fibromyalgia"? a) The article doesn't discus...
A: The given article summarises the use of Annona muricata L. leaves for preventing fibromyalgia. It gi...
Q: Illustrate the Parental and F1 cross
A: Trihybrid cross is between the two individuals of a species for studying inheritance of three pairs ...
Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino aci...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A c...
Q: what is ASTO or ASO test? discuss the principle it's important
A: ASTO/ ASO test is Anti- streptolysin O test. Antistreptolysin O is an antibody produced in human bo...
Q: life history patterns and how different
A: Life history-A history of the changes through which an organism passes in its development from the p...
Q: Can a monohybrid cross be used to illustrate Mendel’s principle of independent assortment?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: The cell above is a lung cell of a salamander. In whichstage of mitosis is it? What are the structur...
A: A cell cycle is a series of processes taking place in a cell to grow and divide into two identical c...
Q: Edmontosaur or hardosaurs what ways can they defend itself from predators like large with powerful j...
A: INTRODUCTION Endmontosaurs They are large dinosaurs lived in North America during late Cretaceous pe...
Q: Question:- Explain how CO,-in dependence of light –regulates the transition to flowering. Include th...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: True or False: The output of the Mass Spectrometer gives us the exact mass of a molecule.
A: The output of the mass spectrometer is the separation of molecules based on their m/z (mass to charg...
Q: If you will be discussed how synapse work and its feature, what will you say? How would you connect ...
A: Synapses are part of the network which links sensory organs in the peripheral nervous system to the ...
Q: How does photosynthesis transform solar energy into the chemical energy of sugar molecules? Match th...
A: Photosynthesis is making energy-rich molecules like glucose, in the presence of green pigment Chloro...
Q: Explain why some—but not all—of an organism's genesare expressed
A: Only a fraction of genes are expressed at a given time. Gene expression is important for cell divisi...
Q: intermediate filaments 1. In eukaryotic flagella, the fibers that slide past one another due to the ...
A: Intermediate filaments: They anchors the nucleus and maintains its rigidity Microtubules: They aids ...
Q: Movement of glucose from one side to the other side of the intestinal epithelium is a major example ...
A: Digestion of carbohydrates produces monosaccharides.
Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...
A: Introduction: Hyperkalemia is a condition of high potassium levels in blood.
Q: The drug butenamide blocks the co-transporters for Na+ and Cl- in the ascending limb of the loop of ...
A: The drug butenamide is a loop diuretic whose main function is to block the Na+ k+ 2cl- co transport...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: Edmontosaur description
A: Edmontosaurus is a genus of hadrosaurid dinosaur. It contains two known species: Edmontosaurus regal...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: back ground study of ampalaya
A: Introduction: Ampalaya is also known as Momordica charantia found in the tropical regions of the wor...
Q: Question 25 Which of the following statements is NOT true? O 45% of the incoming shortwave radiation...
A: The incoming solar radiation that hits the boundary between the Earth's atmosphere and outer space, ...
Q: 3. Explain the movement of indirect protein transport; where are the proteins made, WHere Jie they g...
A: Mechanical protein digestion begins in the mouth and progresses to the stomach and small intestine. ...
Q: Instruction: The answer must be in minimum of 2 paragraphs and each paragraphs must have a minimum o...
A: Sex is a trait that determines an individual's reproductive function, male or female, in animals and...
Q: Does changing the sequence of nucleotides always result in a different amino acid sequence? Explain
A: No, changing the sequence of nucleotides does not always result in a different amino acid sequence.
Q: how do you explain behavior using brain dynamics?
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are ...
Describe the way a Punnett square is used
Step by step
Solved in 2 steps