Q: Organism Characteristic A В E Morphology Rod Rod Coccus Coccus Rod Motile Yes Yes No No Yes Gram…
A: Please follow step 2 for detailed explanation.
Q: meant monggo seeds as in Mung seeds (Vigna radiata)
A: Mung beans can be germinate in four to five days but the actual rate of germination may varies with…
Q: Hello! Discuss in details, the adaptations that Orobanchaceae (plant) has evolved to invade and…
A: Some parasitic plants in the family Orobanchaceae, such as Striga, Orobanche and Phelipanche, often…
Q: Please summarize how the virus interacts with the cells in the airway and lungs and is related to…
A: SARS CoV 2 enters the body via inhalational route. Its particle size is small enough to reach deeper…
Q: Drug-resistant populations of microbes arise when __________________________. Group of answer…
A: Introduction :- Microbes can also pass on genes to one another, including those that make them…
Q: QUESTION 20 Use the pedigrees below to answer the corresponding. What is the most likely mode of…
A: Given: A pedigree. Have to determine the mode of inheritance for the trait.
Q: Figure 3: /Zea mays/ Shoot tip 7 12 11 10 8 For questions 7-12, refer to Figure 3. Identify the…
A: In Zea mays the apical meristem is also known as the growing tip. It is undifferentiated…
Q: In visceral Leishmaniasis culture of the biopsy material on NNN medium results in: a. amastigote…
A: Answer
Q: Please help with the following: Simple genetic diseases are expected to be ______________ in the…
A: ANSWER;- b) Rare depending on the severity of the disease. Explain;- Rare human genetic diseases can…
Q: Use examples to explain how plant parts move in response toenvironmental stimuli.
A: Introduction :- Plants react to a variety of stimuli. Tropism is the response to environmental…
Q: Question: For bacterial gene transfer via conjugation to occur, the host bacterium must possess a…
A: The conjugation of the bacteria plasmids is called bacterial conjugation and in this here is direct…
Q: Cell theory 1. 2. 3.
A: Biology is the vast subject that is has many subdivided branches. Among these many branches one of…
Q: In a recent influenza epidemic, physicians were utilizing a rapid diagnostic test to determine which…
A: Influenza It is a viral infection caused by influenza virus. This virus infects the respiratory…
Q: Describe the agar-overlay technique
A: Biological techniques are methods or processes used to study living things. Methods, approaches,…
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: Is an increase in albumin excretion observed only in pathological urine? Why or why not?
A:
Q: Galapagos marine iguanas are differentiated by islands. However, the iguanas swim well, suggesting…
A: Answer :: The proportion of alleles (m) of isla tortuga fr isabela. Allele A frequency p=0.2 in next…
Q: Create a food web and Trophic Pyramid for an identified ecosystem. Only drawings Requirements:…
A:
Q: What is seed dormancy? Why is it good?
A: In terms of a species' survival, the seed is a crucial stage in the higher plant life cycle. It is…
Q: The structure of a lipid bilayer is determined by the particular properties of its lipid molecules.…
A: The plasma membrane's basic structure is a lipid bilayer, which is made up of two leaflets of…
Q: Petunias normally have purple flowers. Suppose you identify a recessive mutant that has white…
A: Petunia have purple flower in wild type phenotype. Whereas the white flower are present due to…
Q: Choose the Management Principle that best describes the picture provided. WORLD ANIMAL PROTECTION O…
A: World Animal protection is an organisation that focuses on the animal rights and give importance to…
Q: Outline the structure of the brain, spinal cord, peripheral nerves and the autonomic nervous…
A: The nervous system of the human body is broadly divided into two groups, first being the central…
Q: Methods of determining the variety and abundance of life forms (species assemblage and dominants) in…
A: Species diversity represents the the number and abundance of total species in a particular…
Q: A diabetic's blood sugar cannot be controlled because their pancreas can not produce enough insulin.…
A: Diabetes is a condition when the person cannot secrete enough insulin to regulate glucose levels in…
Q: onsidering the number of base pairs, compute for the actual length (in micrometers) of this DN
A: There are 7 base pairs. Length of one base pair is 3.4 Angstrom. Length of 7 base pairs is 3.4 X 7=…
Q: The enzyme armylase digests.
A: Amylase is an enzyme made up of protein. It is specific with its substrate and its substrate is…
Q: This question follows from the last question The D value for a resistant strain of bacterial spores…
A: Time required to ensure a SAL of 10^6.
Q: Why does a red blood cell plasma membrane need transmembrane proteins?
A: Introduction:- RBCs require transmembrane protein to connect the cell's outside with its interior.
Q: To determine: The dietary and medical interventions that are effective in treating type-1 diabetes.
A: Introduction: Diabetes is a condition in which the body's ability to process food for energy is…
Q: What is seed dormancy? Why is it good?
A: ANSWER) The state of seeds when they are not able to undergo germination in the most unlikely…
Q: To impress your PI you design an experiment using –omic methods to test how your E. coli adapts to…
A: The accumulation of genetic mutations that promote cellular fitness is essential for evolution. We…
Q: transport systems
A: Metabolic pathways: The reaction sequence within the organism in an orderly and regulated way is…
Q: cells are part of an organ in the digestive system. Use evidence to explain how the intestinal cells…
A: Human digestive system chiefly consist of gastrointestinal tract and associated glands.The process…
Q: _____ describes the situation when the immune response generated against an influenza strain limits…
A: Introduction An immune response is a process that takes place within an organism in order to…
Q: Because bacteria are able to replicate at high rates, they aresubjected to mistakes or mutations…
A: Mutations in genes Single DNA base alterations, as well as minor intragenic deletions and…
Q: You are studying a type of bacteria isolated from the acidic water runoff of a mining operation. You…
A: INTRODUCTION In chemistry, pH traditionally denoting "ability of hydrogen" is a scale used to…
Q: Modern Taxonomists Using www.ncbi.nlm.nih.gov/Taxonomy/Taxldentifier/tax identifier.cgi.…
A: Taxonomic identification: Taxonomic identification is the process of recognition of the character or…
Q: Which of the following is never found in prokaryotes? A. Ribosomes B. DNA Polymerases C. Golgi…
A: Cells which lack a true nucleus or membrane-bound organelles are called prokaryotic cells. These are…
Q: Explain specifically how osteoporosis affects the bone matrix and the normal bone remodeling cycle.
A: Bones have a cycle of resorption and bone formation. During the day time, calcium is released from…
Q: Fill in the negative homeostatic feedback loop to determine how your body will respond hormonally to…
A: Blood pressure is the blood circulation pressure against the sides of the blood vessels. The bulk of…
Q: 2. Consider the following paragraph from a peer-reviewed publication detailing the extraction and…
A: Lectins These are defined as glycoproteins. They have the ability to make bonds with carbohydrates…
Q: Your dog has been diagnosed with disseminated blastomycosis (a disease caused by a fungal pathogen…
A: Eosinophilia occurs when a large number of eosinophils are recruited to a specific site in your body…
Q: The muscle cell membrane of the neuromuscular junction is called the A. Synaptic cleft B. Motor end…
A: Introduction The neuromuscular junction (NMJ) is a highly specialised synapse that connects a motor…
Q: To identify: The body cavity enclosing the organs heart, small intestine, large intestine, lung, and…
A: The body cavity is the space within the human body where organs and other structures are housed.…
Q: QUESTION 3 a) Discuss briefly on secondary productivity in an ecosystem.
A: Productivity Productivity in an ecosystem refers to the percentage of energy that enters ecosystem…
Q: 2. Consider genes that have 2 alleles each. Gene 1 has allele "E" and "e", where E is dominant to e.…
A: A dihybrid test cross is a cross between a double heterozygous individual and a double homozygous…
Q: Question - Summarize the goals of conservation biology .
A: Conservation biology- It is an applied science based on ecological principles. it focuses on…
Q: 3. Техt membrane receptors? A. reducing the amount of ligand available to bind the receptor…
A: cell signaling is a process of receiving, processing, and transmitting signals.
Step by step
Solved in 2 steps
- Provide three biological reasons why sycamore aphid numbers and distributions may differ between leaves on the same tree?Discuss the differences in species distribution between mainland and islands.Identify a species that your group thinks is ok to drive to extinction and justify the reasons for this decision. Can you anticipate any consequences of losing this species from the Earth?