To identify: The body cavity enclosing the organs heart, small intestine, large intestine, lung, and kidney.

Q: Create a food web of an Urban Ecosystem (UTAH) 1. Include: producers, primary, secondary, tertiary…

A: An ecosystem can be defined as a functional unit of nature, where living organisms interact among…

Q: Compare what happens with each "key player" at the lac operon when lactose is present vs. not…

A: Lac operon is a simple prokaryotic group of genes for the metabolism of lactose. It consists of…

Q: 1. Male and female animals have a pair of gonads. What advantages does it provide to the species?

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: You discover a new species of animal that has a backbone running down the length of its body. What…

A: Introduction:- From the base of the skull to the tailbone, there are bones, muscles, tendons, and…

Q: Homing and navigation in salmon (across developmental stages; e.g., from stream to ocean and back to…

A: Homing in migrating fishes, such as salmon, can be defined as a behavioral pattern in which an…

Q: Whereas _____ is the predominant immunoglobulin in intestinal fluid, _____ is the dominant…

A: Cell is a simple machine that houses all of the essential organelles required for life's sustenance.…

Q: QUESTION 1 Loci Recombination Frequency (%) L and M 50 L and N 19 L and O L and P 50 50 M and N 50 M…

A: The test cross is done to find the genetic map. The crossing of unknown parent is done wit…

Q: A diabetic's blood sugar cannot be controlled because their pancreas can not produce enough insulin.…

A: Diabetes is a condition when the person cannot secrete enough insulin to regulate glucose levels in…

Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…

A: Introduction  The term "population" usually refers to the number of people living in a specific…

Q: normal humans have essentially non-equivalent sensory organs and structures, both anatomically and…

A: Answer :: All normal humans have non equivalent sensory organs is true, Because,   Sense organs…

Q: If an embryo splits at the two-cell stage, each of the resulting identical twins will have its own…

A: Identical twins:  The splitting up of the embryos into two at the two-cell stage leads to the…

Q: 1. Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…

A: Test cross is a cross between F1 individual and recessive individual. By crossing the F1 individual…

Q: For this question please can I have sketch of a map of the pMBBS plasmid showing the relative…

A: Restriction enzymes are also called molecular scissors. These are generally employed in cutting the…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: Put Koch’s postulates in order.(a) The disease organism must be isolated in pure culture.(b) The…

A: Microbiology is a branch of science that studies microscopic organisms that are not visible to the…

Q: Distinguish between catabolism and anabolism.

A: Metabolism refers to the chemical events that take place in the cell to produce energy. The acquired…

Q: owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…

A: Sex linked Allele is present on the sex chromosome that is  usually on the X chromosome. Autosomal…

Q: For this statement, answer True or False and explain your answer briefly. A urine sample cannot be…

A: Introduction Forensic toxicology:- It is the application of toxicology to cases and issues where bad…

Q: It is necessary to develop a string matching method that may be used to compare two or more…

A: To determine patterns over sequences and to determine different matching pattern we use string…

Q: The elderly tend to have difficultly absorbing vitamin A with age. O a) True b) False

A: Vitamins are the organic compounds which are required by our body in small amounts for maintaining…

Q: Why is a weed significant as a pest?

A: Introduction Pest:- It is defined as a living organism, either an animal, fungus, or plant that is…

Q: how will osmoregulation help our body in maintaining homeostasis?

A: Homeostasis is a phenomenon of regulation of inside environment of the body . This allows body to…

Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…

A: In plants; each part have different roles to play for the proper development of plants.

Q: Explain the phylogenetic tree using OTUs presented.

A: OTUs are the individual species or even groups of species that are represented in a phylogenic tree.…

Q: VARIATION IN POPULATION DENSITY OF BEETLES 401 35 30- Species A Species B .** Species C 25 20+ 15…

A: Introduction Evolution is the process of a species' traits changing over numerous generations…

Q: What is the difference between endergonic andexergonic chemical reactions?

A: A chemical reaction is the transformation of one or more reactants into one or more products.…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A:

Q: All of the following have contributed to the obesity epidemic in young teens EXCEPT: a) increased…

A: Obesity is a national problem that contributes to some of the country's leading causes of mortality,…

Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…

A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…

Q: The probability of having an individual recessive for all gene pairs from the cross Aabb x aaBb is O…

A: This is a case of dihybrid cross because there are involved two genes. These genes are A and B.

Q: Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now…

A: Given, ACC GCG GTT TAC TTT GCC CGA ATT GAT GA

Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: Mike is a 34-year old male who reports to the ER after a motorcycle accident. MRI results show that…

A: In a person that has transected spinal cord injury between T1 and L1, it would have paraplegia.

Q: Calculate the observed frequencies of genotypes C"C* , C°C, and C'C' at Day 7. (The observed…

A: The Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population…

Q: Describe the difference between a transcriptional fusion and a translational reporter gene fusion.…

A: Transcription fusion means cloning the promoter of interest, upstream of any transcription unit,…

Q: Describe the unique way that auxin can move through a plant.

A: Auxins are a type of plant enzyme that resembles morphogens in some ways. Auxins are important for…

Q: Match the term in column A with its description in column B

A: The terms are correctly matched with the contents below

Q: QUESTION 9 For the mating below, indicate whether nondisjunction occurred in the mother, father,…

A: Introduction Genetic analysis refers to the general process of studying and investigating genetics…

Q: Figure 1.1 50 Passengers | Crew 40 • Half-day "Cruise cancelled 20 10 10 11 12 13 14 15 16 17 17* 18…

A: INTRODUCTION Salmonella Heidelberg (S. Heidelberg) is a bacterium that can cause severe illness in…

Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…

A: Introduction:- *The Suliformes is a recognised order by the Ornithologist Union.  * In light of…

Q: HO HH C-N-C -C- OH R +H20 H H C-N-C N-C OH OH H. R. The chemical reaction illustrated in the…

A:

Q: what are the issues that should be addressed in a risk assessment and the risk management plan for…

A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…

Q: What are the similarities in how receptive fields are represented by the nervous system?  What…

A: In this particular question we have to describe about receptive field and how these are related with…

Q: (Y=black/y-yellow). The heterozygotes are the color mixture called calico or tortoise-shell. What…

A: The coat color is encoded by the genes present on the X chromosomes.  The black color is present in…

Q: what gasses are released in this experiment?

A: Photosynthesis is a process which is used by plants, algae and few bacteria. This turns sunlight,…

Q: Question - How does the female reproductive system protect itself from pathogens?

A: Female reproductive system is highly protected from pathogen invasion,

Q: 2. Many animals preferentially assist individuals with whom they are most familiar. Explain how such…

A: Introduction Kin refers to someone you are related to a member of one's family.

Q: 2. Next, use the Hardy-Weinberg equation (p + 2pq + q = 1) to calculate the expected frequencies of…

A: Answer given below. If you like the answer please rate. thank you.

Q: what is central dogma of biology? Is it entirely accurate?

A: Central dogma of Molecular Biology deals with the biomolecules such as DNA, RNA and proteins. It was…

Q: Poverty and hunger drive people to bear more children. a) True b) False 35 0

A: Not 100 % true but it true...