Answered: Discuss how mutations in the 5’ splice…

Name: Discuss how mutations in the 5’ splice site, 4’ splice site or branch
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Discuss how mutations in the 5’ splice site, 4’ splice site or branch point of an intron may disrupt RNA splicing and what the effect may be on the phenotype

Science

Biology

Discuss how mutations in the 5’ splice site, 4’ splice site or branch point of an intron may disrupt RNA splicing and what the effect may be on the phenotype

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Explain how each of the following processes complicates the concept of colinearity. Q. Trans-splicing
There is a situation in which a gene has five exons. Please draw four possible mature products of the gene if there is alternative splicing.
Identify alternative splicing variants of this transcript, NOT including the original unspliced variant. (Select all that apply.) a) Exon 1, Exon 3, Exon 4 b) Exon 1 and Exon 4 c) Exon 1, Exon 2, Exon 4 d) Exon 2, Exon 3, Exon 4 e)Exon 1, Exon 2, Exon 3, Exon 4
What is a difference between prokaryotic and eukaryotic gene expression? Please explain. Also, discuss briefly the significance in splicing, why this is done and how this leads into variety of different polypeptides.
Below is the RNA sequence of a primary transcript. Underline (or highlight) each intron, and then clearly show a point mutation that would prevent intron two from being spliced out. Assume each intron is spliced using the 5' and 3' splice sites that are closest to each other. GCUACGACGAUGGAUGCGACUCGUUCACAGACUGAGGCUUGAUUGUCAGAACGCGCUGGAUGAUAGCUUGAUCGAUAAUAAACGACUACGAUCGCUCGAUCGAACGACCG
Discuss the advantages, in terms of protein structure and evolution, that result from alternative mRNA splicing.
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene will be spliced. Indicate which introns and exons will be found in the mRNA after splicing occurs.
Select the three post-transcriptional modifications often seen in the processing of mRNA in eukaryotes: Group of answer choices heteroduplex formation; base modification; capping 3'-capping; 5'-poly(A) tail addition; splicing 5'-poly(A) tail addition; insertion of introns; capping removal of exons; insertion of introns; capping 5'-capping; 3'-poly(A) tail addition; splicing
The diagram, shown in attatched image, shows an mRNA that is alternatively spliced. The alternatively spliced variant contains Exon 1, Exon 2, and Exon 4. Indicate below if a splice site is used, blocked by a modifying protein such that the spliceosome must choose a different site, or skipped to make this alternatively spliced variant.
The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: capping cleavage of polycistronic mRNA removal of poly A tails reverse transcription splicing
A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing pattern at each site is independent of that at all other sites, how many splicing products are possible?