Discuss the salient feature of DENR Administration Order No.142, Series of 1989

Q: How was the first natural antibiotic discovered? (To answer this question, identify the antibiotic,…

A: Antibiotics are antimicrobial substances that are active against microorganisms. It is the most…

Q: Outlined the mechanism of accidents on the highway injury's in Indiana and geographic area for that…

A: Injuries are the leading cause of death and disability among people under age 35 in the United…

Q: Which of the following statements best describe the equation P = G + E + (G X E)?*   a. The…

A: Introduction  The term "phenotype" refers to an organism's visible physical characteristics, such as…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: he arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…

A: When the pressure inside the arteries is less than the pressure outside the arteries (due to…

Q: How do antibodies work to eradicate pathogens?

A: Antibodies can be referred to as specialized Y-shaped proteins which have the ability to degrade the…

Q: For another patient, the following results are öbtained: RBC count = 3.20 x 1012/L HGB = 5.8 g/dL.…

A: Given: Red blood cell indices includes in the complete blood count test that measures the various…

Q: The habit of a perennial plant's dropping its leaves, which have all died, at the end of the growing…

A: The answer is d. Deciduous

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides

A: Introduction - A gene is a basic unit of heredity in biology, as well as a sequence of nucleotides…

Q: SPR is one of many techniques to examine binding affinities of biomolecules. Choose another…

A: SPR is a signal peptide that can arise from the exit site of the ribosome and forms the ribosome SRP…

Q: Glycolysis and gluconeogenesis are irreversible processes and that both occur largely in the cytosol…

A: Reciprocal Regulation of Gluconeogenesis and Glycolysis   The processes of gluconeogenesis and…

Q: Which one of the following statements about the propagation of the action potential is incorrect? O…

A: The action potential is any shift in the membrane potential due to an increase or decrease of…

Q: Describe the conjunctiva and state its function. Name the primary glands of the endocrine system…

A: Conjunctiva: The conjunctiva is basicay a part of eye. It's a losse connective tissue which…

Q: 8. Renal clearance of glucose in a normal healthy person is A. O ml/min B. 40 ml/min C. 90 ml/min D.…

A: C.90ml/min

Q: Discuss how Genome-wide association studies (GWAS) can be used to identify genetic risk loci for (a)…

A: GWAS helps in screening the genome across the databases to find the desirable results without having…

Q: What are the hormones that the hypothalamus produces?

A: The hypothalamus of the brain contains two sets of neurosecretary cells whose hormonal secretions…

Q: Types of Reproduction (Sexual or Asexual) Organisms Method of Reproduction 1. Hydra 2. Banana 3.…

A: Budding is hydras' most frequent asexual reproductive technique. Buds emerge from the point where…

Q: The reason due to which the calico cats are ealways considered as female.

A: As per the Humane Society, whereas any kind of cat can be bred with calico fur, the great majority…

Q: oncept Mapping: Fill-in the concept map of egg release (start with the ovary). Use the following…

A: The egg is collected by finger-like extensions on the end of the fallopian tubes as it is discharged…

Q: How many clades are represented in Figure 20?

A: Clade  A clade is a graphic representation of group of organisms that includes it's ancestor as well…

Q: A person’s blood type is the result of expression of a gene with three alleles. However, only 2…

A: The blood group is determined by the presence of specific antigen on the plasma membrane of red…

Q: 2. If K=N, what is true about a population of organisms? It is at 0 individuals b. It stops growing…

A: When K=N, dN/dt= rN(K-N)/K Here, dN/dt represents- rate of population change K=carrying capacity  N=…

Q: How do populations (or strains) of microbes evolve resistance to antimicrobials? (For this question,…

A: Introduction Antibiotics are antibiotics that are used to treat bacterial infections in humans and…

Q: What is the major function of lysosomes? They: A. package proteins B. detoxify toxic substances C.…

A: Lysosomes serve as the cell's digestive system, degrading material brought in from outside the cell…

Q: In a screening test for Chlamydia, the sensitivity is 83% and specificity is 50%.  A total of 800…

A: ANSWER;- The following table from the given information:     Truth         Disease Not Disease…

Q: Why is pH important for the buffer?   The pH is important to the stability of the gel.     The pH…

A: @ Why is pH important for the buffer?  Answer - pH is important for buffer for processes and/or…

Q: When a certain body arna manitest an typeromia, increased capilary fitration and sweoling, mis…

A: Introduction Hyperemia is a condition in which there is an excess of blood in the vessels of a body…

Q: Name the three divisions (parts of the ear).

A: We will answer the first question as exact one question is not specified. Please send back the…

Q: What role does the human microfauna play in protecting humans against pathogens? (At this point in…

A: The human host and its microbial flora form a complex ecosystem whose balance is a striking example…

Q: What is NADP and NADPH?

A: Cofactors Cofactors are the inorganic non-protein molecules or ions that are necessary for the…

Q: Where do optometry  work? eg private/small business operators; large health service systems eg…

A: Introduction Optometry:- It is a healthcare profession which involves examining the eyes and related…

Q: What are three (3) of the most serious negative consequences of massive tropical deforestation?

A: The most serious negative consequences of tropical deforestation is as given below:-

Q: What is Medical Terminology, why is it beneficial to know , what is it used for …. How can it be…

A: Introduction :-   Medical terminology is a vocabulary that is used to precisely describe the human…

Q: How does the presence of gill slits in all vertebrate embryos support the theory of descent from a…

A: Introduction :- A multicellular organism's embryo is the first stage of development. Embryonic…

Q: _________ is the greenhouse gas produced by anaerobic bacteria in irrigated rice agroecosystem.  2.…

A: Carbon dioxide, methane, nitrous oxide, flourinated gases are examples of greenhouse gases.…

Q: Sickle cell 1). how many people does it affect? 2) Is it genetic and if so what chromosome is the…

A: Sickle cell disorder :-

Q: Based on temperature requirements which of the following is not correct?*   a. Coconut and mango are…

A: Different plants are adapted to different regions and temperature zones. Some plants require high…

Q: acrial sporophyte alternation of generation antheridjum collumella cuticle elaters hydroids…

A: Plants are photosynthetic , autotrophic organism that belongs to plant kingdom . It mainly comprises…

Q: Name of organisı Features used to ID: d.

A: The given diagram shown is the diagram of the filamentous green algae that lives in the fresh water…

Q: Why are Amphotericin B and Azoles selectively toxic for fungus? (Define selectively toxic and…

A: A fungus is a type of eukaryotic organism which comprises microbes like yeasts and moulds, as well…

Q: What is the ploidy of two daughters of a dividing cell of a hornwort’s gametophyte?   Select one:…

A: The hornwort belongs to bryophyta. The root, stem and leaves like structure are present in the…

Q: SPOI.

A: The principle cytotoxic lesion for radio-mimetic chemicals and…

Q: Let: 0e = time in minutes *e = number of bacteria 20 40 60 80 100 120 140 160 180 200 2 4 8 16 32 64…

A: In this question, we are given data on the growth curve of bacteria. The graph can be drawn by…

Q: 1. Briefly discuss the folowing; (a) sources of microorganisms in low-heat-processed meat products;…

A: The non-vegetarian food is highly nutritious in nature and has a very high amount of protein…

Q: How does thyroid hormone be carried in the bloodstream? Why? What is the mechanism of action of this…

A: Introduction The thyroid hormone is the hormone that controls your body's metabolism, growth, and…

Q: What is the PAR receptor?

A: In biology, receptors are chemical structures made up of proteins that aid in signal transmission by…

Q: a. Carbon Cycle i. Producers ii. Consumers iii. Decomposers iv. Methanogenesis

A: Carbon cycle is the biogeochemical cycle by which carbon is exchanged among biosphere, pedosphere,…

Q: How does intermittent fasting relate to carbohydrates, lipids, proteins, nucleic acids, enzymes etc.…

A: Intermittent fasting (IF) is a term used to describe a variety of eating patterns in which no or few…

Q: Diseases of the female reproductive system are generally treated by a physician called a The male…

A: The testes are important for creating sperm and manufacturing testosterone, the principal male sex…