Q: Please help me answer this question, more than one answer given may be correct: Figure title:…
A: Crabs are osmoregulators, meaning they can regulate the concentration of salt and water in their…
Q: Hookworms, parasitic nematodes transmitted through contact between bare feet and soil, infect nearly…
A: 3 a) As the hookworm is nematode parasite , to find the FST between these two given population that…
Q: Biological evolution is best defined as A. the process of direct observation B. unchanging nature of…
A: Biological Evolution: Biological evolution refers to the process by which species of organisms…
Q: A flask containing an aquatic plant in water is placed next to a light. A sensor that detects the…
A: Chloroplasts are special organelles in plant cells that can convert solar energy into chemical…
Q: blank (unfilled) necropsy report layout for animals
A: The permanent record of all the pathological findings of animals after they are pronounced dead. It…
Q: What is the pH of an aqueous solution of 7.37x10-2 M potassium hydroxide? PH =
A: Introduction A solution's pH value indicates how basic or acidic it is. It is based on the quantity…
Q: The evidence supporting biological evolution includes A. all of the above B. patterns of…
A: The process by which the genetic makeup of populations of organisms changes over time, resulting in…
Q: Breast cancer is one of the most common cancers among women. The exact cause of breast cancer is…
A: Breast cancer is a disease characterized by the abnormal growth of cells in the breast tissue.…
Q: True or false the cell membrane equalizes osmosis pressure to protect cell.
A: Introduction: Osmosis is the transfer of water molecules across a semipermeable membrane from a…
Q: The fraternal birth order effect, in which the number of brothers a boy's mother carried before him…
A: Introduction Birth order refers to the position of a child in a family relative to their siblings.…
Q: What are the products of photosystems II and I in noncyclic electron flow? Draw a Z-scheme shows the…
A: In the light-dependent processes, there are two different types of photosystems: photosystem II and…
Q: How do I solve this problem? An IV of 750 ml was ordered to run in 6 hours with a set that is…
A: When administering intravenous (IV) fluids, it is crucial to calculate the flow rate accurately to…
Q: You have isolated a novel bacterial species from the surface of rose leaves. Explain the process you…
A: Novel bacteria refer to bacterial species that have not been previously described or identified by…
Q: 1. For each of the following organisms, report its relative growth at the various pH levels.…
A: Introduction Bacterial growth refers to the increase in the number of bacterial cells in a…
Q: Which of the following factors does not directly affect cardiac output? the volume of blood ejected…
A: Cardiac Output: Cardiac output (CO) is the amount of blood that the heart pumps out per minute. It…
Q: We are required to create a certain topic on our Evolutionary Biology class. And the topic is what i…
A: Antibiotic resistance evolution facilitated by a concentration gradient is a complex and concerning…
Q: 4) Consider the production of flower color in the Japanese morning glory (Pharbitis nil). Dominant…
A: Considering the flower color production in the Japanese morning glory (Pharbitis nil). Genotype for…
Q: The fungus Botrytis cinerea is a pathogen of plants, and causes high losses of strawberry crops…
A: Introduction:- A pathogen is an organism that causes disease in another living organism. Pathogens…
Q: 1. Identify the pointed structure in the 3 the representative species of protozoans. 2. Features to…
A: Protozoa are unicellular eukaryotic microorganisms that come in a wide variety of shapes and sizes,…
Q: The following pedigree shows a family in which an inherited condition is apparent. The muscle biopsy…
A: A pedigree chart is the graphical representation of a trait or disease in a family tree. It shows…
Q: In Elves, curled toes (T) is dominant to flat toes (t). If an Elf that is heterozygous were crossed…
A: Heterozygous refers to an individual having two different alleles for a particular gene, while…
Q: Create a concept map that illustrates transcription in eukaryotes by including the following terms:…
A: There are three types of RNA polymerases in eukaryotes: RNA polymerase I, II, and III, which are…
Q: How is Dermatophytosis managed and controlled in animals and humans?
A: Ringworm, also known as dermatophytosis, is a common fungal infection of the skin, hair, or nails…
Q: Eventually, the peak will not be able to increase in size even if the stimulation intensity…
A: The compound action potential (CAP) is defined as the summation of each nerve fiber's action…
Q: 0 What is phenotypic plasticity? O When a phenotype is exaggerated in males. O When a phenotype is…
A: Introduction:- Phenotypic refers to the observable characteristics or traits of an organism that…
Q: 3. The genes for the human blood types MN and Ss are closely linked genes on chromosome 4. A sample…
A: A. To estimate the gametic and allele frequencies, we first need to calculate the total number of…
Q: How would an increase in the rate of cellular respiration influence the rate of net photosynthesis?
A: Cellular respiration and net photosynthesis have a complex and interdependent relationship. Both…
Q: Replication of nuclear DNA begins at the Ori (origin of replication). True or false
A: Introduction Replication is the process by which a cell makes a copy of its DNA. It is an essential…
Q: 1. Provide a natural/biological example of the following types of energy. a) The energy represented…
A: Introduction: Potential energy is energy that an object possesses by virtue of its position or…
Q: d Glycoproteins are placed on the surface of the cell for identification of the cell from other…
A: Introduction: Proteins called glycoproteins have sugar molecules bonded to them. In reality, these…
Q: Entamoeba coli cyst Size: Taxonomy: Phylum: Class: Order Family: Genus: Species:
A: Entamoeba: Entamoeba coli is a species of ameba, a type of protozoa that can infect humans. While…
Q: What provides a structural core to an extending growth cone? a) Filopodia b) Microtubules c)…
A: Microtubules are long, thin, cylindrical structures made up of tubulin protein subunits that play a…
Q: With the aid of diagrams, explain how the polymerase chain reaction (PCR) can be used for detection…
A: Polymerase chain reaction (PCR) is a molecular biology technique used to amplify small segments of…
Q: i need help finding the the type of metagenomic data that the study gathered in the article and…
A: The article titled "Metagenomics of pasteurized and unpasteurized gouda cheese using targeted 16S…
Q: PCR is used. A. all of these B. to solve crimes C. to diagnose genetic diseases D. to study gene…
A: Note:- Please always mention the needed parts in case of multiple questions. Thank you! Polymerase…
Q: Create a graphic organizer about the complex process involved in odontogenesis
A: Odontogenesis is the term used to describe the process of developing teeth, which starts during…
Q: Multiple Answer: Choose all correct answers the lag phase is associated with the highest levels of…
A: Introduction Bacterial growth refers to the increase in the number of bacterial cells in a…
Q: Deamination of cytosine to form uracil can happen spontaneously during replication. It can be…
A: Deamination is a chemical process that removes an amino group from a molecule, such as a nucleotide…
Q: If you stimulate the nerve twice, and you only see one peak, what does that mean for the state of…
A: Neurons have the capability of generating and conducting nerve impulses and they are the functional…
Q: What would be the correct response of the myogenic mechanism to regulate glomerular filtration rate…
A: Maintaining a proper glomerular filtration rate (GFR) is necessary because it ensures the nephrons…
Q: "On the rapidity of antibiotic resistance evolution facilitated by a concentration gradient" The…
A: Antibiotic resistance refers to the ability of bacteria or other microorganisms to resist the…
Q: Gametophytes develop into gametes and sporophytes develop into spores. True False In mosses and…
A: Introduction: Sporophytes are the diploid (2n) phase of the life cycle of plants that undergo…
Q: Which of the following excretory organs does not employ ultrafiltration? A. The Malpighian tubules…
A: Introduction: Under high pressure, a semipermeable membrane is used to filter blood or other bodily…
Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…
A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…
Q: Please watch this video and answer the questions. What is a Tagine (it is more than one thing)?…
A: Nutrition is the study of how nutrients in food are processed, absorbed, and utilized by the body…
Q: Draw a schematic diagram for the preparation of broth media in a laboratory set-up.
A: Broth media is a type of liquid medium for growing microbial, plant or animal cells. it contains…
Q: The order is for Augmentin 200 mg PO every 8 hours. You have on hand Augmentin 125 mg in 5 mL. How…
A: Augmentin is the brand name for a combination of two antibiotics: amoxicillin and clavulanic acid.…
Q: Echinoderms have a water vascular system, which is a key trait of this phyla. Select the features of…
A: Echinoderms This refers to a phylum of marine invertebrates that includes starfish, brittle stars,…
Q: - In terms of Na and K ion gradient /movement - what causes the action potential (positive charge…
A: The Na+ K+ ion gradient refers to the concentration difference of sodium (Na+) and potassium (K+)…
Q: The physician ordered Leukeran 4 mg po twice a day. You have on hand Leukeran 2 mg tablets. How many…
A: Leukeran is a medication that is used to treat certain types of cancer, including lymphoma, chronic…
please rewrite it just in words
i dont need handwritten
Step by step
Solved in 2 steps
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
- 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acidsDNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- 30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
- C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAU