Answered: 11. Transcription is the flow of…

Name: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acids

Science

Biology

11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acids

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Related questions

Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…

A: Transcription is the initial stage in gene expression, when information from a gene is used to build…

Q: The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams. Which of the…

A: The primary function of rRNA is the synthesis of proteins by binding to mRNA and tRNA to ensure the…

Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…

A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…

Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…

A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: What is the difference between transcription and translation during the central dogma of molecular…

A: The gene expression is divided by mainly two steps that are transcription and translation. Together…

Q: 1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…

Q: What serves as the template for making new MRNA?

A: In transcription process a template strand is used to make a new RNA.

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: . What is a consensus sequence?

A: Genes are the typical genomic sequence which undergoes transcription to produce the different types…

Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…

A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…

Q: 1. What are the types and major functions for each type of RNA?

A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…

Q: The following DNA sequence corresponds to the complete coding sequence of a gene that codes for a…

A: mRNA codons are used to determine sequence in the original DNA and anticodons of tRNA. tRNA…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…

A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…

Q: How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not…

A: Translation is a process which takes place after transcription, in which the genetic information…

Q: It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the…

A: A ribonucleoprotein (RNP) is a complex of ribonucleic acid and RNA-binding protein.

Q: What would be the effect on reading frame and gene function if: Two bases were inserted into the…

A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs…

A: The process by which a cell makes an RNA copy of a piece of DNA. This RNA copy, called messenger RNA…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: If the following piece of DNA were used as a template for transcription, what would the sequence of…

A: Transcription the process in which RNA is formed out of the DNA the processing that is translation.…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: What do “Transcription” and “Translation” mean in the context of molecular biology?

A: Molecular biology involves the study of composition, structure and interaction of nucleic acids…

Q: What does it mean when we say the genetic code is redundant? a) A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…

A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: Which of the following is a true statement concerning RNA? Group of answer choices a. mRNA is single…

A: The RNA or ribonucleic acid is a nucleic acid polymer that it is produced from the DNA by the…

Q: Arginine has the mRNA codons a. CGG, CGA, and AGG b. CGU, CGC, and CCC c. CGG, AGG and UGG d. AGA,…

A: The genome of any organism contains various genes which are transcribed into mRNA and then…

Q: ) Assuming that transcription starts with the first C in the template strand, and continues to the…

A: Transcription Transcription is the process in which the template strand of DNA is copied into mRNA…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…

Q: Serine has the mRNA codons Select one: a. AGU, UCG, and AGC b. UCA, UGA, and UCC c. AGU, AGG, and…

A: Serine is an amino acid (synthesized in the human body) and is present and functional in many…

Q: Which of the following is the definition of a gene? A. RNA that delivers amino acids to a ribosome…

A: Genetics is a science of the study of genes. It involves the identification of specific genes for…

Q: What would be the effect on reading frame and gene function if:Answer each Two bases were inserted…

A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: Part A) In your own words describe what happens in transcription and translation Include which…

A: DNA(Deoxyribonucleic acid) is defined as type of double helical molecule composed of two…

Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

A: CAT CTA CAA ATA GCA CCT AAT TGT G (DNA)

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: What specifies the modified sequence of nucleotides found in an edited RNA molecule?

A: Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a…

Q: Which of the following must occur before mRNA can leave the nucleus in a eukaryotic cell? I. Introns…

A: Any cell or creature with a clearly defined nucleus is referred to as a eukaryote. The nucleus of a…

Q: It was assumed that RNA was the first genetic material, and RNA can encode proteins that act as…

A: Introduction Oparin-Haldane model demonstrated the chemical evolution and suggested that inorganic…

Q: Which of the following BEST describes the characteristics and function of siRNA? A. a short strand…

A: siRNA or short interfering RNA or silencing RNA is a class of double stranded RNA molecules which…

Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…

A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…

Q: What is a promoter? Group of answer choices A region on mRNA that will indicate the ending point…

A: Promoter These are the DNA sequences which defines where the transcription of gene by RNA polymerase…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acids

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
1. How many codons are there in the Original DNA sequence?
3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
(1) Describe the nitrogenous base pairing in DNA and RNA.(2) Determine the number of bonds in each nitrogenous base pairs.
1. What are the types and major functions for each type of RNA? 2. Define transcription and translation. Which process occurs first to make protein from DNA? 3. In what direction does a polymerase move when synthesizing a strand of mRNA?
5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of nucleic acid d)More information is needed
1. How are nucleotides formed? In details summarize the process of DNA replication. In details summarize the process of Translation and post translation process. In details summarize the process of transcription. Explain how do you sequence the DNA
4. The structures within living cells that contain the genetic material is called A Chromosome B. Nucleosome C. Ribosome D. Nucleolus
4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.
f the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be? A. 5’-AGAUCCUGA-3’ B. 5’-UCAGGAUCU-3’ C. 5’-AGUCCUAGA-3’ D. 5’-AGATCCTGA-3’ E. 5’-UCAGGATCT-3’
1. Describe and list the steps involved in DNA replication. 2. Create a timeline of transcribing events. 3. Outline the steps of the translation process. 4. Describe the mechanism of action of antibiotics that target the protein synthesis process.
9. What is the RNA world hypothesis and why is it called that?