Elaborate on Common Reproductive System Diseases: (Pathogen, Symptoms, Diagnosis, and Treatment)Note: Follow the table below.CandidiasisBacterial VaginosisTrichomoniasis DiseaseCandidiasisBacterialvaginosisTrichomoniasisPathogenFungus,CandidaalbicansBacterium,GardnerellavaginalisProtozoan,TrichomonasvaginalisOdor, Color, andConsistency ofDischargeYeasty or none,white, curdyFishy: gray-white,thin, frothyFoul, greenish-yellow; frothySymptomsAmount ofDischargeVariesCopiousCopiousAppearance ofVaginalMucosaDry, redPinkTender, redpH (normalpH is 3.8-4.2)>4.55-6DiagnosisMicroscopicexamPresence ofclue cellsMicroscopicexam; DNAprobes;monoclonalantibodyTreatmentClotrimazole;fluconazoleMetronidazoleMetronidazole

Reproductive System Diseases:the disease transmitted by sexual contact and produce infection of…

Answered: Elaborate on Common Reproductive System…

Elaborate on Common Reproductive System Diseases: (Pathogen, Symptoms, Diagnosis, and Treatment) Note: Follow the table below. Candidiasis Bacterial Vaginosis Trichomoniasis

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter11: Health Of Aquatic Animals

Section: Chapter Questions

Problem 5KA

See similar textbooks

Related questions

Q: What are the additional parts of a bacterium needed for infection of host? Answer this completely…

A: One of the most diverse groups of living things is bacteria, which have evolved to a wide range of…

Q: LO73 Determine which nucleotides are methylated based on a sequence that has been treated with…

A: Introduction : Bisulfite sequencing is the process of treating DNA with bisulfite before performing…

Q: 5- crossover misalignment. B-Causes a duplication of a certain portion of chromosome while the other…

A: Introduction:- Evolution is defined as the descent with modifications. Evolution of life forms is…

Q: Skeletal productivity can be quantified by dividing the maximum diameter of the ____ by the diameter…

A: Skeletal robusticity indicates the strength of a skeletal section in relation to some mechanically…

Q: 1. True or False: 1. WBC's, like monocytes can live for years 2. Changes in elevation affects…

A: 1. First of all, monocyte itself is a WBC. Also life span of WBC's is around 13 to 20 days and not…

Q: What is Scientific revolution? Why do we students have to learn about this?

A: Answer : Early modern science was reproduced during the scientific revolution, when discoveries in…

Q: Following a fracture of cervical vertebra a patient exhibit spastic paralysis on the right upper and…

A: Given that the patient has a fracture of cervical vertebra, spastic paralysis on right side and loss…

Q: Pollen contains the complete genetic material of the plant and is airborne. Describe the ways in…

A: Pollen represent the highly reduced from of male plant's gametophyte. It is usually called as…

Q: Predation is an interaction between two species best described how? One species benefits from the…

A: Predation is the type of interaction in which an organism (predator) kills and eats the other…

Q: apolysis Known as instar The Stage from another is True o False one to

A: Question:- The stage from one apolysis to another is known as instar True False Right answer:-…

Q: generated from this gene. Be sure to appropriately label the ends of the molecule.…

A: Introductions Transcription is the DNA based gene expression, DNA segment will be copied…

Q: QUESTION 27 What is meant by simultaneous translation transcription and why can this happen in…

A: The process of converting a gene's DNA sequence into an RNA molecule is known as transcription, and…

Q: A temperature-sensitive mutant allele of Ras causes the Ras protein to be fixed in the GDP-bound…

A: Introduction The various kinds of genes that have an abnormal function at higher temperatures and…

Q: What is the function of the nose in terms of the respiration tract and air being drawn into the…

A: Ans: Nose is the fleshy protrusion in the middle of the face made up of skin and other soft tissues,…

Q: There two questions that will be asked interview for applying to be in the lab field. What are your…

A: My strengths are ---- Im completed my degree with a very good performance and i'm a skilled…

Q: Cancer develops from the accumulation of multiple mutations within a single cell. Name the 3 sources…

A: Errors in DNA replication during cell division, exposure to mutagens, or viral infection can all…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: How does RNA polymerase recognize the start and end of a gene?

A: The crucial enzyme that converts the genetic data encoded in DNA or deoxyribonucleic acid to RNA or…

Q: Which of the following is an objective for the following study: Male birds are usually more colorful…

A: Males are often more colourful than females in the animal world because of sexual selection. This…

Q: LO 61 Explain how Next gen sequencing works What is true about Next gen sequencing? Amplifies a…

A: Option 4 (It can sequence a whole genome in one huge strand) is also true.

Q: S A widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her both have a…

A: Given that widow's peak is dominant (W) over straight hairline (w). Therefore, person with a…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction Gene expression is the process through which a gene's information is utilised in the…

Q: .is stachyose found in plant‘s seed or root？or leaf？ 2.Does stachyose present in human‘s milk？ 3.…

A: A tetrasaccharide called stachyose is made up of sucrose and an alpha-D-galactose moiety that is…

Q: A fish suddenly has to swim in order to escape a predator. This type of activity is and uses ATP…

A: Fish are aquatic animals that live in the sea, rivers, lakes, and oceans. Individuals increasingly…

Q: What method allows researchers to make a large amount of human proteins in bacteria? Select one: a.…

A: The correct answer is option d. Gene cloning. Gene cloning is one of the methods that allow…

Q: Why is variation advantageous to populations? How does this relate to species that reproduce…

A: Reproduction is a phenomenon of fusion of two gametes and formation of zygote . It is a…

Q: Choose the answer that correctly fills in the blanks. As carbon dioxide accumulates in the…

A: More carbon dioxide is evaporating into the ocean as a result of human-driven increases in…

Q: In mitosis, why do the chromosomes need to condense in prophase and line up in metaphase? (To be…

A: Mitosis is a process in which eukaryotic cells usually divides into two. Prokaryotes usually lacks…

Q: During the 20th Century, scientists in the USSR undertook a program to domesticate foxes. The…

A: Foxes who were most willing to interact with humans were considered the most tamed ones. They were…

Q: The two molecules of pyruvate (pyruvic acid) results in the following products 2 molecules of…

A: pyruvate is a end product of glycolysis cycle. pyruvate oxidation in mitochondrial metrix produce…

Q: 6. Most of the water and solutes is absorbed in the large intestine 7. Antibodies are produced from…

A: Large intestine are responsible for majority of water and solute absorption, whereas small…

Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…

A: A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell…

Q: Which of the following is a correct way to distinguish reptiles from amphibians? a. Reptiles have…

A: Reptiles are vertebrates whic are cold blooded. They have dry skin that is covered with scales or…

Q: For this plant with binomial name Ixora coccinea L., What is the reference to the publication of…

A: Linnaeus named the genus Ixora in 1753; but, historically, it has frequently been merged with the…

Q: Why is it more likely that insertions or deletions will be more detrimental to a cell than point…

A: Frameshift mutations Point mutations It refers to the mutation that changes the reading frame of…

Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…

Q: Once the nucleotide in the picture is added to the 3’end of growing strands, DNA synthesis is…

A: Introduction: DNA molecule end has a number. One end is referred to as the 5' (five prime) and…

Q: Examine the structure shown below and answer the following questions: 1. Name the structure (be as…

A: Nucleic acids or nucleotides are usually consists of mainly nitrogen bases, sugar, and phosphate…

Q: Would the viral insertion of a proto-oncogene into a region of genomic DNA with non-acetylated…

A: Acetylation reduces the affinity between histones and DNA by removing positive charges. Thus,…

Q: a) Suppose the frequency of the recessive allele a for the recessive condition albinism is 0.2…

A: According to our guideline we can answer only first three subparts of a question. So, upload the…

Q: Choose 1 organism below and propose a method of fossilization that most appropriately matches the…

A: The fossil record is a highly organized series of fossils discovered in sedimentary rock strata.…

Q: A beaker contains two compartments (A and B) with equal volumes of solution separated by an…

A: Since beaker A contains 3% albumin solution and beaker B contains 2% potato starch solution.…

Q: What is the climate for modern society and how does climate change impact the environment, if at…

A: Environmental science is one of the sciences that we must learn that every living thing on this…

Q: A certain autosomal recessive trait occurs in a population with a frequency of 1 in 4900. Assuming…

A: According to Hardy-Weinberg Principle, there will be a constant genetic variation in a population…

Q: this did not answer d, e, and f of part (c)

A: The enzymes here given are those enzymes which mainly control the metabolism of glucose and…

Q: Squirrel’s probable causes for the endangerment, extirpation, etc Please include references you use…

A: Due to some human activity, species can enter into a new geographical area which is different form…

Q: The head of the oncology divison of a large biotech company proposes to develop a therapeutic…

A: For cancer treatment, there are several options. The treatment a patient receives depends on the…

Question

Elaborate on Common Reproductive System Diseases: (Pathogen, Symptoms, Diagnosis, and Treatment)

Note: Follow the table below.

Candidiasis
Bacterial Vaginosis
Trichomoniasis

Disease
Candidiasis
Bacterial
vaginosis
Trichomoniasis
Pathogen
Fungus,
Candida
albicans
Bacterium,
Gardnerella
vaginalis
Protozoan,
Trichomonas
vaginalis
Odor, Color, and
Consistency of
Discharge
Yeasty or none,
white, curdy
Fishy: gray-white,
thin, frothy
Foul, greenish-
yellow; frothy
Symptoms
Amount of
Discharge
Varies
Copious
Copious
Appearance of
Vaginal
Mucosa
Dry, red
Pink
Tender, red
pH (normal
pH is 3.8-4.2)
>4.5
5-6
Diagnosis
Microscopic
exam
Presence of
clue cells
Microscopic
exam; DNA
probes;
monoclonal
antibody
Treatment
Clotrimazole;
fluconazole
Metronidazole
Metronidazole

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.