Endogenote Exogenote Mating bridge Sex pilus M A tube connecting an F+ to an F- bacterium during HGT that single-stranded DNA can be passed through. E The DNA naturally occurring inside a host cell. Connection between a donor bacterium and a E recipient that a single strand of DNA is passed through. Attaches to a recipient bacterium to stabilize it

Endogenote Exogenote Mating bridge Sex pilus M A tube connecting an F+ to an F- bacterium during HGT that single-stranded DNA can be passed through. E The DNA naturally occurring inside a host cell. Connection between a donor bacterium and a E recipient that a single strand of DNA is passed through. Attaches to a recipient bacterium to stabilize it

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 4DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

The transfer of DNA from one bacterium to another through a sex pilus is termed ___________? Question options: translation transcription conjugation transduction apoptosis transformation Following conjugation between two F- individuals, the DNA recipient _________. Question options: remains F- becomes F' evolves into a new species becomes Hfr becomes F+ nothing; an F- cell cannot conjugate with another F- cell
A bacterium has a genome size of 4.4 Mb. If a researchercarries out shotgun DNA sequencing and sequences a totalof 19 Mb, what is the probability that a base will be leftunsequenced? What percentage of the total genome will beleft unsequenced?
QUICK I WILL RATE NO EXPLANATION NEEDE D Which of the following is not correct regarding genetic material transfer? When virulence plasmids are transferred to the bacteria, they become virulent The resistance plasmids also carry transposons and IS elements that have resistance genes to antibiotics IS elements and transposons can cause mutations in genes Insertion sequences and transposons are fixed genetic elements of chromosomal origin
Because bacteria are able to replicate at high rates, they aresubjected to mistakes or mutations being made in their nucleo-tide sequence. For example, the nucleotide sequence in a genecoding for a protein might be AATTGGCCA but because ofmutation might become GGTTGGCCA. How may such a mu-tation become beneficial to the bacterium? How may it becomeharmful?
An ade+ arg+ cys+ his+ leu+ pro+ bacterial strain is knownto be lysogenic for a newly discovered phage, but the siteof the prophage is not known. The bacterial map isleucysarghisadeproThe lysogenic strain is used as a source of the phage, andthe phages are added to a bacterial strain of genotypeade- arg- cys- his- leu- pro-. After a short incubation,samples of these bacteria are plated on six differentmedia, with the supplementations indicated in thefollowing table. The table also shows whether colonieswere observed on the various media.PresenceMedium Ade Arg Cys His Leu Pro of colonies1 - + + + + + N2 + - + + + + N3 + + - + + + C4 + + + - + + N5 + + + + - + C6 + + + + + - NNutrient supplementation in medium(In this table, a plus sign indicates the presence of anutrient supplement, a minus sign indicates that asupplement is not present, N indicates no colonies, and Cindicates colonies present.)a. What genetic process is at work here?b. What is the approximate locus of the prophage?
The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
Microbiology q you introduced mutations into bacteria. However, the bacteria have the same characteristics as before. What kind of mutations do the bacteria have? O base deletion Oframeshift O missense O silent O nonsense
I'm lederberg experiment ecology colonies grow in a sense of bacteriophage when transferred by replica plotting onto 2 plates with bacteriophage they observed some colonies resistant to bacteria phage what did the observation allow them to conclude
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
As described in Figure, host DNA is hydrolyzed into smallpieces, which are occasionally assembled with phage proteins, creatinga phage with bacterial chromosomal DNA. If the breakage ofthe chromosomal DNA is not random (i.e., it is more likely tobreak at certain spots as opposed to other spots), how might nonrandombreakage affect cotransduction frequency?
In the lysogenic cycle of bacteriophages, which of the fol-lowing is true?(a) Lysogeny is the term applied to a temperate phage thatdoes not replicate itself independently and does not lysethe bacterial host cell.(b) Phage DNA is incorporated into the host bacterium’sDNA, at which time it is called a prophage.(c) Temperate phages can be replicated either as a pro-phage along with bacterial chromosomal replicationor can suddenly revert to the lytic cycle by replicatingthemselves and assembling into new phages.(d) All the above are true.(e) a and c only.
Particles that transfer genetic material from one species to another, especially in marine prokaryotes horizontal gene transfer lateral gene transfer genome fusion device gene transfer agents