Practice question: I understand how the F1 progeny is found (by punnett square), but I do not get how they were able to get the F2 progeny (can i use a punnet square? How do i find these results?) Example from Drosophiladp: dumpy++/++dp cn/dp cncn: cinnabar45 map units apart++/dp cnxdp cn/dp cnF1Expect 45%recombinantprogeny250wild type++/dp cn246dumpydp cn/dp cnF2cinnabar5dumpydp +/dp cn7cinnabar+cn/dp cn

Detailed explanation: Let's break down how the F2 progeny is obtained in a genetic cross experiment…

Example from Drosophila dp: dumpy ++/++ dp cn/dp cn cn: cinnabar 45 map units apart ++/dp cn x dp cn/dp cn F1 Expect 45% recombinant progeny 250 wild type ++/dp cn 246 dumpy dp cn/dp cn F2 cinnabar 5 dumpy dp +/dp cn 7 cinnabar +cn/dp cn

Example from Drosophila dp: dumpy ++/++ dp cn/dp cn cn: cinnabar 45 map units apart ++/dp cn x dp cn/dp cn F1 Expect 45% recombinant progeny 250 wild type ++/dp cn 246 dumpy dp cn/dp cn F2 cinnabar 5 dumpy dp +/dp cn 7 cinnabar +cn/dp cn

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: et’s suppose we have downloaded the structure of Hemoglobin from PDB. Now we want to retrieve the…

A: Understanding the three-dimensional structure of proteins is basic in bioinformatics since it gives…

Q: What is an adaptation in the context of evolution? A heritable trait that was favored by natural…

A: The objective of the question is to understand the concept of adaptation in the context of…

Q: DATA DELTA Y-ROUND OFF •GRAPH (individual) # Table 1 1. Lead R wave amplitude (mV) 2. CLASS DATA…

A: You've identified a good point about the rationale for diagnostic studies! Here's how we can improve…

Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…

Q: Answer the following questions about insulin: 1. What is the difference between general…

A: Question 1General transcription factors and specific transcription factors, also known as genetic…

Q: Consider that you are a civilian resident living on the Chatham Island in New Zealand where a…

A: The alternate hypothesis proposed for the long-finned pilot whale stranding event on Chatham Island…

Q: 4. The diagram below shows the original order of the genes on an autosome in Drosophila: C D EFGHI…

A: You may refer to the following references for the answers:…

Q: In the 1960 's the advertisement for a lecture by a whimsical biologist began as follows: "Available…

A: Certainly! Let's break down the advertisement piece by piece:1. "Available now. Linear Motor. Rugged…

Q: Match the definitions on the left with the vocabulary words on the right. The level of diversity…

A: The number of different species within a specific region or area. -> Species diversity. The…

Q: List all the antibiotics in the above table that work through destroying the bacterial cell wall.…

A: In addition to the four described above, glycopeptide antibiotics target the bacterial cell wall.…

Q: two reasons as to why it is important to understand genetics in everyday life

A: The first reason why understanding genetics is important in everyday life is because it helps us…

Q: Let's say: a drosophila melanogaster line is bred in a lab, which has a phenotypic variation of…

A: Steps involved in identifying SNP variants in the wingless gene (wg1) of Drosophila melanogaster and…

Q: The Andes Mountain Range is located along the western coastline of South America and includes a…

A: let's delve into more detail:(a) The Andes Mountain Range is the result of the convergence of two…

Q: how did your heart rate change with body position? when was it the lowest? highest? Use the heart…

A: Key references:https://www.kenhub.com/en/library/anatomy/heart

Q: DNA cloning refers to a. making cloned bacteria. b. making cloned sheep or other eukaryotic…

A: Sure! DNA cloning involves the creation of exact copies of a particular DNA fragment or sequence.…

Q: Water absorption by roots is under the influence of

A: Transpiration is a process through which the loss of water takes place from the exposed parts of the…

Q: Upon antigen exposure, antigen binding sites;. is the first antibody produced with is the second…

A: The correct answer is:IgM; 10; IgA; 4; IgG; 2Here's the explanation:IgM: This is the first antibody…

Q: Genetics Q3

A: The objective of the question is to understand the safety measures that need to be taken when using…

Q: Thrombocytosis, an elevated platelet count, occurs in some cancers and in qualitative disorders of…

A: The question is asking whether thrombocytosis, which is a condition characterized by an elevated…

Q: Nitrogen Content Assay Method II l is also known as? Micrometric Method Semimicro Method…

A: Deciding the nitrogen concentration of a material is fundamental within the region of chemical…

Q: cardiac output drops, then A and B • A and C Blood flow must decrease Blood flow must increase The…

A: The objective of the question is to understand the physiological changes that occur when cardiac…

Q: please answer the following: 1. how would each be distributed and please complete the chart2.…

A: which is a diagram about the crossing of Species X and Species Y, here's how the chromosomes would…

Q: State and explain 3 factors that affect enzymatic activities

A: Here are 3 factors that affect enzymatic activities and how they influence enzyme function:Substrate…

Q: After watching video that’s linked please answer the questions! Thank you!…

A: In diabetes, the body faces difficulties in regulating blood sugar levels due to problems with…

Q: Rainforest plants from which we extract medicines would be considered as a provisioning service.…

A: A provisioning service is any type of benefit to people that can be extracted from nature. Along…

Q: Suppose an efficient conducting system evolved in a moss that could transport water and other…

A: Mosses are the flowerless, non-vascular and small plants that are generally present in shady or damp…

Q: Genetics Q9

A: The question is asking us to identify the correct definition of a plasmid from the given options.

Q: 1.) An increase in volume H 1 ! 80 888 F1 F2 F3 F4 F5 ALWAYS results in an increase in pressure.…

A: 1. Relationship Between Volume and Pressure:The statement "An increase in volume ALWAYS results in…

Q: answer both 5 and g i also got an answer for 5 which is…

A: The genetic code is the system by which the nucleotide sequence of DNA is translated into the amino…

Q: In cladograms, sister groups are______ . a. inbred c. represented by nodes b. the same age d. in the…

A: Evolution is the change in the characteristics of a species over several generations. The…

Q: The English physiologist William Harvey made all of the following circulatory discoveries except:…

A: The objective of the question is to identify the statement that is not a discovery made by the…

Q: In bending in the binding of the myosin head of the free binding site of the actin filament results…

A: Muscles consist of numerous muscle fibres. Each muscle fibre contains many myofibrils with…

Q: Describe some of the key characteristics of Homo habilis - the first species in our genus "homo".…

A: I hope these suggestions and recommendations help you with your assigned tasks. To further…

Q: -What do records for salamander mussels tell us in the absence of records for mudpuppies? -Can we…

A: Salamander mussels (Pleurobema cordatum) and mudpuppies (Necturus maculosus) are two species that…

Q: The table below shows four organisms and the biological processes each uses. Select the organisms…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: In 2019, a couple died from plague after eating uncooked rodent spleen (a delicacy where they were…

A: The symptom set that characterizes both plague and Ebola includes high fevers, sore throat, and…

Q: What is photosynthesis?

A: Photosynthesis is a biological process that occurs in green plants, algae, and some bacteria. It is…

Q: In what stage of mitosis is the cell labeled "A"? A shutterstock B www.shutterstock.com 159810452 O…

A: During metaphase, which is a crucial stage of mitosis, the cell undergoes several key events as it…

Q: iruses that kill host cells are (a) lysogenic (b) lytic (c) viroids (d) prophages (e) temperate

A: In virology, the relationship between viruses and their host cells can lead to diverse results,…

Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…

A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…

Q: w to Identify structural sequences, such as telomeric sequences, in chromosomes ?

A: Identifying basic sequences in chromosomes, such as telomeric sequences, is vital for understanding…

Q: Students filled three identical flasks with water and placed elodea, a type of aquatic plant, in…

A: Explanation:The presence of dissolved oxygen in water is closely related to the process of…

Q: Relative Hormone Concentration 8 12 ♡ Days of Estrous Cycle The graph above shows the hormonal…

A: Approach to solving questions about a graph:Identify the key elements:Labels: Look for titles, axis…

Q: DATA ANALYSIS 1. What electrical and mechanical events correlate to the P wave? The QRS complex? The…

A: Detailed explanationQuestion 1The P wave is the electrical signal that causes the atrium to…

Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…

A: The given answer calculates how long it will take for bacterial populations to quadruple in perfect…

Q: Why are chromosomal abberations considered to have less significance than gene mutations for…

A: The question is asking about the relative significance of chromosomal aberrations and gene mutations…

Q: What is the source of genetic variation in a population? Natural selection Mutation and sexual…

A: The question is asking about the sources of genetic variation in a population. Genetic variation is…

Q: Describe Hemolytic Disease of the Newborn (HDN). Who is at risk for this disease? How can it be…

A: Certainly! Let's dive deeper into Hemolytic Disease of the Newborn (HDN) to understand its causes,…

Q: Consider this scenario following several generations of frogs and then answer the following…

A: In the context of evolution, the key indicator of evolution occurring is a change in the allele…

Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…

A: The question is asking which of the given options would decrease the uptake of water by a plant root…

Question

Practice question: I understand how the F1 progeny is found (by punnett square), but I do not get how they were able to get the F2 progeny (can i use a punnet square? How do i find these results?)

Example from Drosophila
dp: dumpy
++/++
dp cn/dp cn
cn: cinnabar
45 map units apart
++/dp cn
x
dp cn/dp cn
F1
Expect 45%
recombinant
progeny
250
wild type
++/dp cn
246
dumpy
dp cn/dp cn
F2
cinnabar
5
dumpy
dp +/dp cn
7
cinnabar
+cn/dp cn

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Give examples of constitutive and facultative heterochromatin in:a. Drosophilab. humans
Define the following terms:a. positive supercoilingb. negative supercoilingc. polyaminesd. chromatine. nucleosome
Outline the molecular steps in the process of X-chromosomeinactivation (XCI). Which step plays a key role in choosing whichof the X chromosomes will remain active and which will beinactivated?
during anaphase of animal cells, describe the appearance of the DNA, spindle fibers and location of the chromosomes pls do not copy from google
You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA -- GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). Using the wild type DNA sequence above as a guide : Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: T --> G transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14 Mutant 4: transition at nucleotide 7 Mutant 5: An insertion of GG after nucleotide 40 Mutant 6: transition at nucleotide 15 Mutant 7: a deletion of nucleotide 25
The length of dogs’ legs varies widely across species, with the Nova Scotia duck tolling retriever representing a short-legged breed. Genome-wide association studies (GWAS) linked this phenotype to a locus on Canine familiaris (CFA) chromosome 12 with strong similarity to the FGF4 gene on chromosome 18. Further work demonstrated that both loci are transcribed. Note: CpG islands (green in diagram) often mark active promoters; we will discuss in a later lecture. Based on the diagram below, what do you think is the relationship between these two loci? The genome sequence shows another locus on chromosome 10 that is almost identical to the one depicted above on chromosome 12, from 5’UTR through 3’UTR. The gene does have one polymorphism, though, in exon 2, that distinguishes it from the Chr. 12 gene. You have developed an assay to easily distinguish mRNA derived these two variants. However, when you assay the Chr. 10-derived mRNA, you don’t detect anything at all.…
he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…
Describe the appearance of a Drosophila embryo, in which the knirps gene protein-coding sequence has been replaced by lacZ, following incubation in a solution of X-gal.
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below? In addition to phosphorylation, the C-terminal domain of p53 can also be acetylated and sumolated in response to DNA damage. Acetylation and sumolation both result in an increase in the transactivation ability of p53 and may account for this finding. In vivo, IR induces the acetylation of p53 at Lys320 by PCAF and Lys382 by CBP/p300. Acetylation at these sites is dependent on N-terminal phosphorylation at Ser15 and to a lesser extent on phosphorylation at Ser6, Ser9, and Thr18 (Saito et al., 2002; Wahl and Carr, 2001). All of these phosphorylation events are ATM-dependent, although only Ser15 has been shown to be phosphorylated directly by ATM. Sumolation occurs at Lys386 after DNA damage (Muller et al., 2000). Sumolation refers to the covalent attachment of a small ubiquitin-like molecule (SUMO-1) to Lys residues, but in contrast to ubiquitination, does not result…
Which one of the following represents only a pericentric inversion of AB * CDEF? ( * denotes the centromere) Group of answer choices AB * CEDF ABDC * ABEF FEDC * BA ABAB * CDEF ADC * BEF
Draw a hairpin structure like that shown in Figure 18.5 for the repeated sequence found in fragile-X syndrome (see Table 18.1).