Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area = base X height. - Circle area = radius². - Trapezoid area = (base 1 + base,)X height. %3D Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon"), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: base,, base, and height, or), in which case RuntimeError exception should be raised and the processing should continue. Triangle: 50 48 Shape Area Circle: -10 Trapezoid: 10 12 70 Trapezoid: Triangle Circle 1200.00 9 32 >> invalid dimension Trapezoid Trapezoid 770.00 >> missing data. Sample input file Sample output

Exercise 1: Write a python program that reads from a text file whose name is provided by the user and including lines relating to the dimensions of three kinds of shapes: Circle, Triangle, Trapezoid (see figure below for a sample input file). For each shape compute and display its area: - Triangle area = base X height. - Circle area = radius². - Trapezoid area = (base 1 + base,)X height. %3D Your program should consider the following erroneous cases: • The file does not open/exist • The format of the data in the file is incorrect (e.g. shape name = 'Polygon"), the shape's dimensions are incorrect (e.g. negative value or number of values for a trapezoid not equal to 3: base,, base, and height, or), in which case RuntimeError exception should be raised and the processing should continue. Triangle: 50 48 Shape Area Circle: -10 Trapezoid: 10 12 70 Trapezoid: Triangle Circle 1200.00 9 32 >> invalid dimension Trapezoid Trapezoid 770.00 >> missing data. Sample input file Sample output

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Write a Python program that reads from the user the name of two files (an input file and an output file). The program will then read each line of the input file and save it in the output file preceded with the line number and removing any of the following punctuations (. , ! ? ; :) found at the end of the line. For example, if the input file is:Mary had a little lamb;Whose fleece was white as snow; And everywhere that Mary went; The lamb was sure to go!Then the output file the content of the input file and saves it in the produced output file will beLine 1: Mary had a little lambLine 2: Whose fleece was white as snow Line 3: And everywhere that MaryLine 4: The lamb was sure to go
Exercise 2:Write a Java program that allows the user to specify a file name on the command line and prints the number of characters, words, lines, average number of words per line, and average number of characters per word in that file. If the user does not specify any file name, then prompt the user for the name.
Write a complete python program with a main function that reads from a file called numbers.txt and outputs to a file called answers.txt Numbers.txt has one or more lines where each line contains two numbers Your program should read through numbers.txt and with each line. Multiplies the first number by the second and outputs the results to answers.txt If inputs.txt contained 5 4 3 4 6 4 After your program runs answers.txt should contain 20 12 24
Write a Python program in a .py file that includes the following: Program reads, formats and prints a restaurant menu from menu.txt (see at the bottom).Customer orders menu items by name or an assigned item number until a key word is entered such as "I'm Done" or "Exit".Customer order and net total is printed as output to a new text file. -----------------menu.txt-----------------Ham and Egg Sandwich $15.75Bacon and Cheese Plate $9.50Tuna Salad $12.30Beef Soup $9.00Spicy Beef Barbeque $20.00Pork Barbeque $18.00Oven Chicken Barbeque $15.00Pulled Beef Barbeque Burger $25.00House Salad $5.00Pellegrino $5.40White Wine $7.50Red Wine $11.00
Write a python program that prompts the user for their favorite basketball team. It should be able to read the list of teams provided below in a file called favorite_teams.txt and check if their team is in that file. Teams in the file:JazzBullsMavericksSpursIf the team is in the file let the user know that their team is in the list of favorites. If the team is not in the file, add the team to the end of the file. Also, let the user know that their team will be added to the file.Sample Run in File:What is your favorite NBA team? Jazz [Enter]Your team Jazz is in the listFile before and after run: JazzBullsMavericksSpurs Sample Run not in File:What is your favorite NBA team? Pelicans [Enter]Your team Pelicans is not in the list. It will be added.File before run: JazzBullsMavericksSpursFile after run:JazzBullsMavericksSpursPelicans
Write a program in Python that reads student information from a text file, then creates a text file that records the course grades of the students and a final grade. Each row of the .txt file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student, each separated by a space. A sample of the student information is provided in StudentInfo.txt below. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the .txt file from the user. • Open the .txt file and read the student information using readline() or readlines(). • Compute the average exam score of each student. • Assign a letter grade to each student based on the average exam score in the following scale: ◦ A: 90 =< x ◦ B: 80 =< x < 90 ◦ C: 70 =< x < 80 ◦ D: 60 =< x < 70 ◦ F: x < 60 • Output the first names, last names, exam scores, and letter grades of the students into a text file named…
You have to collect information about the states in your country and then store each states’ name, size, population, Governor, and secret name in a file. Unlike other input, Secret name will be generated from states’ name in a separate method which change vowels alphabet of input string states’ name into the number as given in the following table. ( Table Attached----Table Attached----Table Attached) Write a python program to accept the data for a number of states from the keyboard and store the data in a file in the order in which they’re entered.
Write a program that reads a stream of integers from a file and prints to the screen the range of integers in the file (i.e. [lowest, highest]). You should first prompt the user to provide the file name. You should then read all the integers from the file, keeping track of the lowest and highest values seen in the entire file, and only print out the range of values after the entire file has been read. In Java.
Run a python program that will: a. Read a text file (input.txt) that contains two lines wherein the first line is a normal DNA sequence, while the second line is a mutated DNA sequence. b. The program must also transcribe and translate the sequences by providing outputs for their respective mRNA and protein products. *** input.txt *** ATGGTCAGAACGCGCTGAAATGGTTAGAACGCGCTGAC *** your.py *** Normal RNA Sequence: UACCAGUCUUGCGCGACUUMutated RNA Sequence: UACCAAUCUUGCGCGACUG Normal Protein Sequence: Try Gln Ser Cys Ala ThrMutated Protein Sequence: Try Gln Ser Cys Ala Thr
Write a program that reads a file consisting of students' test scores in the range 0-200. It should then determine the number of students has scored in each of the following ranges:0-24, 25-49, 50-74, 75-99, 100-124, 125-149, 150-174, and 175-200. Output the score ranges and the number of students. (Run your program with the following input data: 76, 89,150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129,149, 176, 200, 87, 35, 157, 189.)
Write a program that reads a student's name followed by five test scores. The program should output the student's name, the five test scores, and the average test score. Output the average test score with two decimal places. The data to be read is stored in a file called test.txt. The output should be stored in a file called testavg.txt. test.txt: A file containing the student names and the five test scores for every student. Andrew Miller 87.50 89 65.75 37 98.50 Green Sheila 91.05 75.88 50.0 65.5 74.30 Sethi Amit 49.82 75 30 74 86.30 testavg.txt: A file containing the student name, the five test scores, and the average of the five test scores for each student.
Write a program that reads student information from a text file, then creates a text file that records the course grades of the students and a final grade. Each row of the .txt file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student, each separated by a space. A sample of the student information is provided in StudentInfo.txt below. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the .txt file from the user. • Open the .txt file and read the student information using readline() or readlines(). • Compute the average exam score of each student. • Assign a letter grade to each student based on the average exam score in the following scale: ◦ A: 90 =< x ◦ B: 80 =< x < 90 ◦ C: 70 =< x < 80 ◦ D: 60 =< x < 70 ◦ F: x < 60 • Output the first names, last names, exam scores, and letter…