explain as precisely as you can but in no more than 100 words the ionic basis of an action potential and how it is passed along an axon.

Q: 49. A 45-year-old woman is diagnosed with breast cancer. Several days later, her husband asks her…

A: 49. A 45-year-old woman is diagnosed with breast cancer. Several days later, her husband asks her…

Q: Compare the ratio of white:black moths in the first generation to much later generations in the…

A: Natural selection can alter the frequency distribution of  alleles and the heritable traits in…

Q: 85. A 16-month-old boy is brought to the office by his 18-year-old mother for a well-child visit.…

A: The time taken by a toddler to learn and  perform toilet by himself can greatly differ. The age of…

Q: 3. Draw a photosystem and label the parts.

A:

Q: Q2- The charge in nerve axon depending on-------inside axon, ----outside axon Na, K OK,Na k,CL

A: In neuron ,  Positively charged Na+ ion is pumped out and  positively chared K+ ion is pumped…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: 82. When a wisp of cotton is touched to the cornea, a blink reflex is initiated. This clinical…

A: Blink reflex is an involuntary blinking of the eyelids caused by the stimulation of the cornea of…

Q: Could you also explain how DNA fingerprinting becomes a disadvantage as it pertains to relatives or…

A: Introduction  DNA fingerprinting is a laboratory technique that uses the nucleotide sequences of…

Q: 6. Which are responsible for the template in the synthesis of proteins which in turn control the…

A: The protein synthesis takes place in the cytoplasm of the cell. The protein synthesis activity and…

Q: If jaguar populations become isolated, would this be enough to classify them as subspecies?

A: Jaguar considered as keystone species that means, they are the apex predators which helps in keeping…

Q: A 50-year-old woman has diminished vibratory sensation on her right arm. Which of the following…

A: The brain and the spinal cord are the two main organs of the central nervous system. Spinal cord…

Q: The antibiotic erythromycin works by blocking ribosomal movement (translocation) along an mRNA, in…

A: Introduction: One of the most prevalent antibiotic mechanisms of action is translation inhibition,…

Q: Analysis of dihybrid crosses, such as seed shape and color, provided Mendel great insight into…

A: A dihybrid cross is a cross in which we study the inheritance of two characters at a time. The…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: How might you use biotechnology to show humans today have Neanderthal genes, and therefore,…

A: Biotechnology is the use of living organisms to create or modify products, or to perform processes…

Q: To describe the life cycle of the typical basidiomycetes.

A: Basidiomycetes can be both beneficial and dangerous. Their attacks on foods and ornamental plants…

Q: A B Blood vessel A supplies two body organs namely the and the

A: The given diagram shows an amphibian circulatory system. The circulatory system is responsible for…

Q: Do you believe were in a mass extinction period right now? Why or why not?

A: A mass extinction is when species are lost much faster than they are replaced.  75% of the species…

Q: In the biological sense of the term (and not psychological!), why can't we say that individuals…

A: The statement individuals do not evolve, populations do is rooted in the (classical population…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Table 1:  F1 ebony flies - 0  F1 non-ebony flies - 560  F1 stubble flies - 560  F1 non-stubble…

A: In genetics, the genes forms the basic inheritance units with its alternative forms called alleles.…

Q: STR ⒸDigital Frog International A B

A: Introduction  The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: write true if the statement if correct and change the bold word/phrase to make it correct in the…

A: Introduction  Amylase is a starch hydrolase enzyme that catalyses the conversion of starch to…

Q: Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G…

A: Introduction Protein synthesis is important as it does various functions in each cell. Without…

Q: Describe the structure of typical fungus.

A: Fungi are eukaryotic organisms that include yeasts, moulds, and mushrooms, but are not plants or…

Q: Where is the fourth ventricle located?   On the midline of the brain, inferior to the corpus…

A: The fourth ventricle of our human body will lies posterior to that of our pons as well as the…

Q: Does this epidemic curve suggest a point source or propagated epidemic? Justify your answer. What…

A: A disease is caused by a deficiency or infectious particles.

Q: Assuming the Denisovans, Neanderthals, and humans were able to interbreed, what does this tell you…

A: Denisovans are group of extinct humans. They first identified based upon DNA sequences from…

Q: To describe how fungi affect the human health.

A: Fungi are heterotrophs, meaning they rely on organic substances for energy and carbon. Nutrients are…

Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…

A: Given: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals…

Q: In squirrels, individuals that are heterozygous for the mutant LDL receptor gene( Fa) begin to…

A: In the case mentioned above, the squirrels experience heart attacks quite early when they have both…

Q: how kranz anatomy is related to a type of photosynthesis (C4) that is more effective than the C3…

A: C3 plants are the plants that uses C3 pathway or Calvin cycle for the dark reaction of…

Q: The pulmonary arteries carry blood

A:

Q: You set an experiment with amoebae and treated them with cytochalasin B, which is an inhibitor of…

A: Actin forms the cytoskeleton of cell ,and plays a major role in formation of pseudopodia which helps…

Q: What is the name of this tissue?

A: Cells  of animal body that are similar in origin structure and function are organised to form…

Q: When working in forestry, knowledge of which of the following is considered essential? A. Astronomy…

A: Forestry is the process of growing trees as a renewable source for timber or biomass, decorative…

Q: An important difference between plant development and animal development is that______ . a. only…

A: Introduction: Plant growth can be described as the increase in volume and/or mass of a plant, with…

Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…

A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…

Q: When Mendel crossed in his P generation a yellow-seeded and green-seeded pea plants, all the…

A: As in F1 generation,all the pea plants have yellow seeds.This means that In pea plants,allele for…

Q: 35, 34 33. 36 32 38. 37. 31- 30- 39. 40, 29 28 27 26 25 45 43 44 24 23 46 L 22 21 2 20 W 6 18. 16 17…

A: The 72 hours chicken embryo contains a bigger embryonic area and four flexures. It contains a…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Mutations are the changes in the DNA sequence, the base sequence of the DNA changes. Mutations can…

Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…

A: Ribosomal Intergenic Spacer signifies the intergenic region between the small and large subunits of…

Q: 3.2. From an anatomical point of view, plants undergo cell differentiation. Zinnia elegans is an…

A: All cells are derived from apical meristems or region of cell division includes the apical meristem…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it  is 15 nucleotide long however on gels there are only 10 bands are present…

Q: Pollen grains are derived from a microsporocyte, developed inside the microsporangia of an anthe and…

A: Flowering plants are known as angiosperms. The reproductive organ of angiosperms is the flower.…

Q: 19. Which class of carbohydrates consist of two monosaccharides that are covalently bond with one…

A: Carbohydrates, also known as sugar molecules, are sugar molecules. Carbohydrates are one of three…

Q: how the animals and plants of a healthy ecosystem are organized and interact.

A: Introduction : The natural connectivity between animals, plants, and their environment is referred…

Q: List processes Microorganisms are involved in (ex., oxygen production)

A: All the organisms which performs the process of Photosynthesis can produce oxygen. Microorganisms…

Q: Explain about information gap of Adaptation of species to changes in the environment ( livestock )

A: A genetic modification that helps an organism's survival in its environment is referred to as…

Q: Briefly discus one geographic factor that might account for the observed pattern in Covid-19 across…

A: COVID 19 :  Coronavirus disease (COVID-19) is an infectious disease caused by the SARS-CoV-2 virus.…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.