Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E ✓ [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ] >

Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E ✓ [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ] >

Name: Match the following (Most appropriate combinations only):IF1IF3IRESSh
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the following (Most appropriate combinations only):IF1IF3IRESShine-Dalgarno sequencem7-G Capaminoacyl tRNA synthetase proofreadingelF4E[Choose ]Binds ribosome A siteTranslation initiation in eukaryotesTranslation initiation in Bacteriabinds mR

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys
A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same effi ciency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
Explain the interactions of specific tRNA with its synthetase, by including the importance of cloverleaf structure of tRNA, which domains are involved, distinct recognition sites, D-arm, TψC arm, anticodon loop and stem, linkage, activation, amino acceptor arm, ensuring the correct tRNA to be recognized by its synthetase. Please do not answer with an incredibly long reply. I would just like the most condensed answer possible by providing all key points asked about. Thanks!
For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.
A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere along the RNA molecule. A synthetic RNA mole-cule has the sequence 5'-CGCUUACCACAUGUCGCGAAC-3'. How many reading frames are possible if this molecule is translated in vitro? How many reading frames are possible if this molecule is translated in vivo, in which translation starts with the codon AUG?
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis, from first to last.30S initiation complex70S initation complexElongation Factor TuElongation Factor GInitiation Factor 3Release Factor 1fMet-TRNA fMet