In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR gene is described as 583 AC (deletion of 1 nucleotide at position +583). At the protein level, the mutation would be described as: a. a nonsense b. a missense c.
Q: Birds differ from their closest relatives, the reptiles, in what ways? (choose all that apply) birds…
A: Answer : birds differ from their closest relatives, the reptiles in the ways as follows : Birds…
Q: Which of the following statements about complex traits is/are TRUE? Twin studies help to…
A: Introduction Complex traits are also known as quantitative traits. Complex traits donot follow…
Q: Questions: 1. What typical forms of stomach disorders has the patient? 2. What violations of the…
A: Gastric juice Gastric juice is a digestive juice secreted by various glands present in the walls of…
Q: What happened to your energy & ability to pinch the clothespin as you progressed through each trial?…
A: As per our guidelines we are not allowed to answer more than one question at a time please ask rest…
Q: Paroxysmal nocturnal hemoglobinuria is a disease characterized by lysis of red blood cells, which…
A: INTRODUCTION Paroxymal nocturnal hemoglobinuria This is a life threatening disease caused by the…
Q: Specimen Mango Apple Strawberry Pineapple Nature of pericarp Type of fruit origin Placentation type…
A: INTRODUCTION The given table is filled below.
Q: ecombination frequencies have been determined between four genes (A, B, C and D) as follows: A-B:…
A: Genes are hereditary units that can be found on chromosomes. With the help of genes, genetic…
Q: A farmer uses a new pesticide. He applies the pesticide as directed by the manufacturer and loses at…
A: Introduction: Natural selection is the process by which residing organism population numbers adapt…
Q: Based on the electron micrograph shown, which of the following statements is/are correct/true?…
A: Introduction :- Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among…
Q: 3-week-old male newborn who was delivered vaginally at 33 weeks' gestation has a bulging anterior…
A: A shunt is a flexible tube or catheter which is specifically placed in a specific position in the…
Q: Discuss the similarities and differences of vertebral column of milkfish, shark, frog, turtle,…
A: Vertebrae: Each of the backbone's sequence of small bones, each with multiple projections for…
Q: Which of the following doesn't occur in the inflammatory response? O A. Decreased vascular…
A: When healthy tissues are wounded by physical/chemical stimuli or are invaded by bacteria, viruses,…
Q: Explain reproduction. Asappp
A: Reproduction is one of the life processes exhibited by living beings.
Q: 1 2 10 mm Frog Tadpole Transverse Section
A: 1. Tail fin 2. Spinal cord 3. Notocord 4. Somite 5. Neuropore
Q: Describe Coronaviruses (genome, structure) .. describe a Coronavirus replication cycle.
A: Introduction :- Coronaviruses are a broad group of viruses that infect humans and cause mild to…
Q: ILLUSTRATIONS. For each of the given proteins: Draw the final location of the following proteins…
A: The process of transcription occurs in the nucleus following which the mRNA is translated in the…
Q: Most abundant large molecule in all living organisms The type of nucleic acid that chromosomes are…
A: Molecule is the combination of atoms of different chemical elements. Chromosome is a structure that…
Q: Explain the process of adaptation of individual organisms to their environment (i.e. some…
A:
Q: Which of the following is correct? All bacteria can form endospores O Vegetative cells are inactive…
A: Staining technique is a method to determining structure of microscopic organism. Staining technique…
Q: Question 3 of 4 Match the following concepts to its specific indications. Match each item to a…
A: A homogenous mixture of a solute and solvent is called a solution. In solution, there are no…
Q: Regarding transcriptional promoter sites, which of the following statements are true? Select one or…
A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…
Q: Which one of the following statements about the afferent components of the respiratory control…
A: Hypoxia causes the small pulmonary arteries to constrict and the systemic arteries to dilate. When…
Q: Describe the initiation of transcription listing all the transcription factors involved and their…
A: Introduction The process of making RNA from DNA with the help of enzymes and proteins is known as…
Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…
A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…
Q: The photosynthetx electron transport causes the accumon of protons n which part of the chloroplast?…
A: A process in phototrophic organisms which helps in generating the chemical energy with the help of…
Q: particular triplet of bases in the template strand of DNA is SAGT- What would be the corresponding…
A:
Q: A neighbourhood that is classified as having poor 'walkability' will have: either low or high…
A: Walkability is defined as the ease of walking safely and arriving to a place within a small distance…
Q: How did Georg Gaffky cultured Salmonella Typhi?
A: Salmonella enterica is a kind of bacteria. Typhoid fever is caused by a gram-negative bacteria…
Q: Recombination frequencies have been determined between four genes (A, B, C and D) as follows: A-B:…
A: Genes are the hereditary units that are exhibited on the chromosome. Genetic information is…
Q: A 45-year-old man undergoes repair of a symptomatic inquinal hernia. Durina the operation. the…
A: Inguinal hernia occurs in inguinal canal. It appears as a bulge on the side of pelvic bone. It is…
Q: ITEM I A B с MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE AGENT GRAM REACTION OXYGEN REQUIREMENT…
A: As per our guidelines we are Not allowed to answer more than three sub parts at a time please ask…
Q: Neoplastic cells typically evade immunosurveillance. Explain how this occurs and describe how…
A: Neoplastic tells are the cancer cells which are created by the uncontrol division of a specific…
Q: 43/ 50 Which of the following molecular structures contan codons? A a protein B mRNA CIRNA DIRNA EB…
A: Introduction :- A codon is a three-nucleotide DNA or RNA sequence that serves as a unit of genomic…
Q: The marks a spot of dead myocardial cells. How does this change the depolarization and muscle…
A: Myocardial cells myocardial cells are located in the heart forming a branched network in the heart,…
Q: The difference between vascular plants and nonvascular plants.
A: Plants are the autotrophic living entities on this planet, that are capable of preparing their own…
Q: Drag and drop to Identify the organelles of this cell. DRAG & DROP THE ANSWER nucleus cytoplasm…
A: Introduction On the planet, there are over 1,000,000 distinctive species. Every organism, whether or…
Q: Use the following additional information to answer the next question. Illustration of a Testicle
A: The testes, also known as testicles or male gonads, lie behind the penis in a pouch of skin called…
Q: Mendel genetics and how meiosis plays into the law of segration and law of independent assortment in…
A: The indirect process of cell division in which the chromosomes of parent cells divide once but the…
Q: The term applied to the movement of lifting your body up onto you "tippy toes" is referred to as:…
A: Muscular system is one of the most important part of the human body, mainly responsible for the…
Q: You want to use some celery that has gone soft and wilted in the refrigerator, for your dinner later…
A: The celery has gone soft and wilted when it was kept in the refrigerator as it has lost some water…
Q: What is the importance of carbohydrates in our body and what are its other functions in animals?
A: Introduction :- Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates…
Q: Homo sapiens appeared in East Africa years ago 300000 O 100000 O 200000 500000 O 400000 O
A: Homo sapiens is the binomial nomenclature for the human species. Homo is the human genus, which also…
Q: Generally it is observed that human males suffer from hemophilia more than human females , who…
A: Introduction :- Hemophilia is caused by a mutation or change in one of the genes that gives…
Q: C3bBb is the soluble C3 convertase that initiates the alternative pathway, while iC3bBb is the C3…
A: The answer is false.…
Q: Incomplete penetrance can make autosomal dominant traits skip generations within a family tree. True…
A: Dominant trait The trait which is shown by individuals in both homozygous dominant and heterozygous…
Q: 29/ 50 Which of the following sms matched A Splicing: Eukaryotic premRNA B Lagging strand Okazaki…
A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…
Q: ITEM MSM MICROBIAL PROFILE MICROORGANISM/CAUS ATIVE AGENT I A GRAM REACTION B OXYGEN REQUIREMENT с…
A: Living organisms on this planet can be categorized into Plants, Animals and Microbes. The microbes…
Q: According to current theories, people addicted to drugs still continue to use them because the…
A: the answer is false.…
Q: Describe the evolutionary mechanisms (natural selection, artificial selection, sexual selection,…
A: EVOLUTION : Evolution is change in the heritable characteristics of biological populations over…
Q: 5 Some protozoa have specialized structures that carryout functions similar to those of a…
A: Introduction Any eukaryotic organism that isn't an animal, plant, or fungus is referred to as a…
Step by step
Solved in 2 steps
- The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain (b) results from the deletion of one or two bases, leading to a shift in the reading frame (c) results from the insertion of one or two bases, leading to a shift in the reading frame (d) results from theinsertion of a transposon (e) usually results in the formation of an abnormally short polypeptide chain
- Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
- Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
- The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′