Explain in 2-3 sentence about the advantage and disadvantage of using plastic in your everyday life.

Q: An individual whose genotype is AABbCc is crossed with an individual who is heterozygous for all thr...

A: Gamete being an organism's reproductive cell,  is a haploid cell which contains only one set of diss...

Q: Lipids General characteristics 1. Little affinity for water because composed of carbon and hydrogen ...

A:

Q: Please answer fast In a population of rats on an island, fur color is determined by one allele wher...

A: All cellular organisms are made of cells. Cells are the basic building blocks of life. Cells contain...

Q: Describe the smaller and largest living unit of Brain

A: Cerebrum is the  largest part of brain however neurone is the smallest unit of brain 

Q: Follow the passage of hemolymph in the insect circulatory system. Explain how the body's natural cir...

A: Hemolymph: it is found in insects as blood, but it is color less. Hemolymph consists of about 90 per...

Q: Describe the way transport proteins selectively move moleculesacross membranes, and give an example

A: Transport protein are the type of protein which are responsible for the transportation of substances...

Q: Why is it important to grossly check a stool sample in a clinical parasitology laboratory?

A: Stool samples are often analysed when there are infections and diseases of the gastrointestinal trac...

Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...

A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...

Q: Protein expression: Given that we control the composition of the medium in which we grow our bacteri...

A: Genetic engineering is the branch of biological sciences which deals with making manipulation in the...

Q: Which of the following is NOT TRUE about photosynthesis? O a) It takes multiple steps. O b) It.requi...

A: Photosynthesis is the light-driven synthesis of carbohydrates in plants. It takes place in specialis...

Q: What type of tissue is the heart made out of

A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...

Q: The primary organ that regulates our hunger is? A. The liver B. The stomach C. The brain

A: Hunger is an uncomfortable or painful physical sensation caused by insufficient consumption of dieta...

Q: Which scientific name below is correctly written and follows all the rules of binomial nomenclature?

A: In scientific writing,  common names are rarely used.  The Latin binomial i.e. scientific name is us...

Q: Discuss the role of the regulator in relation with DNA damage and recombination in the article histo...

A:   Candida glabrata, is species of haploid yeast, it is a nosocomial fungal bloodstream pathogen, thi...

Q: QUESTION 4 Which of the following is required for activation of the adaptive immune system" O Activa...

A: Adaptive immune response is generated when innate immune system cannot eliminate the pathogens.   

Q: Under which scenario can a hawk successfully invade (or persist among) a population of doves?  Grou...

A: The evolutionarily stable strategy, often known as the Hawk-Dove Game hypothesis, is a famous exampl...

Q: Explain : Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages

A: Vpr means viral protein R and it is a HIV  gene and protein product. This gene is responsible for vi...

Q: Albinism is a recessive disorder where there is a lack of melanin. Andrea and her husband Claude bot...

A: Albenism is a recessive disorder it means it will express in an individual only in homozygous condit...

Q: Multiple Alleles:

A: Given: Gene mutations may produce many different alleles of a gene. Some genes may have as many as 3...

Q: What changes to the rules for Dinotefuran use were made by ODA to limit future bee kill incidents a...

A: Dinotefuran is used as a pesticide to kill the the pests or insects which damaged the plants or crop...

Q: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...

A: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...

Q: Illustrate the principles involved in riboswitch control. ?

A: Introduction: In the early 2000s, a new gene regulatory mechanism was uncovered in bacteria. The pro...

Q: What's the role of Protein Phosphatase 1 (PP1) in cell signaling?

A: Protein phosphatase 1 (PP1) belongs to the protein serine/threonine phosphatases family of phosphata...

Q: Which of the following is NOT a defining chordate characteristic? O post-anal tail O vertebrae O pha...

A: Chordate characteristics include presence of notochord, a dorsol hollow nerve cord and paired pharyn...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Amyloidosis

A: Amyloid refers to the abnormal fibrous, extracellular proteinaceous deposits found in organs and tis...

Q: Explain your answers with supporting details.  1. Compare the concepts of Gender, Sex and Sexualit...

A: Answer 1- Gender is the collection of qualities that define femininity and masculinity and serve to ...

Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force) ...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: An ...

Q: Look at the adult mudpuppy, siren, hellbender, and amphiuma Question: What external features illust...

A: The earth is full of biodiversity. Numerous prokaryotes and eukaryotes inhabit the Earth's ecosystem...

Q: The transcription of many bacterial genes relies on functional groups called operons, such as the tr...

A: Turning/switching genes on and off is referred to as gene regulation. Cells start to take on special...

Q: 1. Provided with the following data, compute the corresponding CFU/ml of the original culture. Assum...

A: Various bacterial species are responsible for a variety of diseases in humans. As a result, we apply...

Q: 1.What stage of mitosis would be the most likely to stall if there was an issue with the microtubule...

A: Mitosis: it occurs in haploid as well as in diploid cells. It is decided into many phases such as pr...

Q: Explain Biochemical Evidences. How can it support evolution

A: Introduction :- In biology, evolution refers to the change in a species' features over numerous gene...

Q: . What is the main difference between prokaryotic and eukaryotic cells?

A: There are two types of cells eukaryotic cells and prokaryotic cells, the cells differ in their cellu...

Q: Which of the following are not used for mechanical digestion? A. Pancreatic juice B. Saliva C. Bile ...

A: F- none of the above.  Mechanical digestion involve mastication however chemical digestion involved ...

Q: The endocrine system is composed of glands that secrete hormones that regulate the activity of diffe...

A: The pituitary gland is called the master gland because hormones secreted by it control the activitie...

Q: All of the following are true about lipids except    A. They store more energy than carbohydrates  ...

A: Lipids are a type of macromolecule that contain hydrocarbon. Fats, wax, oil are few examples of lipi...

Q: You are told that the cells on a microscope slide are plant, animal, or bacterial. You look at them ...

A: Cell  Cell is the basic functional unite of any organism.

Q: which climate related factors shape biomes and how might they affect which organisms live in a parti...

A: ANSWER;- Climate includes temperature and precipitation, and it decides the developing season and so...

Q: What are two main criteria for sustainable process analytics in the bioreactor?

A:   Bioreactor is a type of fermentation vessel that used for protection of many chemicals and biologi...

Q: There are _ times less _ ions in solution with a pH 3 than in a solution with a pH6.

A: Introduction In a chemical reaction, a solution can be acidic or basic which depends on the concentr...

Q: A metabolic pathway_____ . a. may build or break down molecules b. generates heat c. can include red...

A: A metabolic pathway is a set of chemical events seen in biological processes that aid in the convers...

Q: What do you think would happen if you tried to view a slide using the oil immersion lens but forgot ...

A: Q. What do you think would happen if you tried to view a slide using the oil immersion lens but forg...

Q: What is the underlying molecular mechanism of action for the antibiotic novobiocin?

A: Novibiocin is an antibiotic produced by the fungi belongs to actinomycete class which is Streptomyce...

Q: A B • Structure A [ Select] • Structure B [ Select] [ Select ] • Structure C is part of the endoskel...

A: A - is the stomach.( Star fish consists of 2 stomach the cardiac stomach and the pyloric stomach. B-...

Q: What traits or innovations allowed movement of animals onto land, and why might these traits have be...

A: Physical or behavioural adaptations are possible. A physical adaptation is a form of structural adju...

Q: What advantages are there to having genes arranged in an operon, compared with the arrangement in eu...

A: The gene is the basic morphological and physiological unit of heredity. DNA is used to make genes. S...

Q: . Identify the phases of mitosis depicted in Figure 3-7 by inserting the correct name in the blank u...

A: Cell division is defined as the process by which cell multiply and involve nuclear as well as cytopl...

Q: The chemical compound that the body uses to identify something as foreign and a potential invader is...

A:   Our body's natural immune system treats  something chemical or maybe some virus or bacteria or ot...

Q: Does the type of the diet of the insect affect the structure of organs/parts of the digestive system...

A: Insects eat by grinding, sucking, lapping, and chewing. Crops are being created in the esophageal ar...

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.