Why is it important to grossly check a stool sample in a clinical parasitology laboratory?

Q: Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond during ...

A: DNA Replication is a process in which two identical copies of DNA are made  from the  parent DNA mol...

Q: What are the major differences in the synthesis and structure of prokaryotic and eukaryotic mRNAs?

A: 1) Prokaryotic: are a single celluler organism that has a diameter of 0.1–5 μm, they have a differen...

Q: Name several general characteristics that could be used to define the prokaryotes.

A: Cells are the fundamental unit of life, and they are the building blocks of all living beings. Life ...

Q: Amyloidosis

A: Amyloid refers to the abnormal fibrous, extracellular proteinaceous deposits found in organs and tis...

Q: hemolymph circulation

A: Hemolymph is a fluid, analogous to the blood in vertebrates, that circulates in the interior of the ...

Q: DNA replication

A: Introduction:- DNA, also known as deoxyribonucleic acid, is a nucleic acid molecule. A 5-carbon deox...

Q: please provide at least one pathogen your method of analysis is used to detect.

A: Disrobe  laboratory method Western blot proteins in an aqueous sample are separated by electrophores...

Q: A crude extract sample was obtained from a plant and was found effective as an anti-diabetic agent i...

A: Therapeutic index or TI = LD50/ED50 TI basically suggests the relative safety. Now, by putting the v...

Q: mutation on HIV replicatication

A: Human immunodeficiency virus = HIV

Q: What's the role of Protein Phosphatase 1 (PP1) in cell signaling?

A: Protein phosphatase 1 (PP1) belongs to the protein serine/threonine phosphatases family of phosphata...

Q: hybridization production of antibiotics vaccine development transgenic animals transgenic plants pro...

A: Recombinant DNA technology(RDT) is widely used in plant tissue culture, animal cell culture,medicine...

Q: What types of gametes are formed by the following genotypes? All gene pairs are segregating independ...

A: The number of gametes formed is determined by the number of heterozygous alleles present within the ...

Q: How can we correlate the activity” ESTIMATION OF ENERGY FLOW FROM PLANT TO HERBIVORE” to laws of the...

A: Autotrophs and heterotrophs are classifications of organisms based on the type of energy and nutrien...

Q: Please answer fast What are two of the four types of tetrads that come from yeast sexual reproducti...

A:       

Q: Calculate the probability of families with the following children:   2 boys and 3 girls? 4 boys a...

A: The formula that can be used to find the probability is: P= n!x! y ! px qy where, P = probability o...

Q: What are the two main types of transport proteins? What are their functions?

A: The act or means by which a molecule or ion is transferred across the cell membrane or through the b...

Q: he following data were obtained from the thyroid uptake study of a patient after administration of I...

A: According to the data provided, the percentage of thyroid uptake of the patient after administration...

Q: Which of the following structures is a vesicle?   Question 2 options:   lysosome   ribosome   mi...

A: The cell is the smallest structural and functional unit of the living organism. Eukaryotic cells con...

Q: QUESTION 1 Vaccination increases the number of: different receptors that can recognize a pathogen ep...

A: The term vaccination is associated with the action responsible for stimulating the human body’s acti...

Q: What roles do membrane proteins play in cell interactions?

A: The direct contacts between cell surfaces that are important in the formation and function of multic...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Please answer fast In a population of rats on an island, fur color is determined by one allele wher...

A: All cellular organisms are made of cells. Cells are the basic building blocks of life. Cells contain...

Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...

A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...

Q: What types of molecules pass easily through the plasma membrane?

A: Plasma membrane plays important role in cell function and in the life process of living organisms. I...

Q: If the cloning was successful and the plasmid contained the elements needed for blue-white screening...

A: The screening of transformants after the cloning is a critical step as it allows the identification ...

Q: QUESTION 4 Which of the following is required for activation of the adaptive immune system" O Activa...

A: Adaptive immune response is generated when innate immune system cannot eliminate the pathogens.   

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a pr...

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying e...

Q: re are two existing hypotheses for an unusually high frequency of a deleterious recessive allele in ...

A: The incidence of a gene variant in the well-known term that they are usually stated that the populat...

Q: What is the meaning of the word sterile? What would happen if culture media freshly prepared were no...

A: Sterile It refers to the state of being free from any bacteria or any other living microorganisms. S...

Q: How is physiological insect defensive mechanisms carried out by the insect circulatory system? Does ...

A: Circulatory system in insects- The circulatory system of insects, like that of all arthropods, is of...

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction  A chemical reaction is a process in which the reactants are converted into a product w...

Q: please answer fast 4-year-old boy of a first-degree consanguineous couple was noted by the parents ...

A: The first-degree consanguineous couple is the relationship between two individuals that are closely ...

Q: Aerobic Respiration Chart Aerobic Respiration Location (Euk/Pro) ATP ATP used produced Type of produ...

A: Aerobic respiration is a process of cellular respiration takes place in the presence of oxygen to pr...

Q: You crossed tall pea plants to another tall pea plants. You collected all the seeds and planted them...

A: Mendel selected pea plants to investigate genetics because they had clearly recognizable characteris...

Q: Multiple Alleles:

A: Given: Gene mutations may produce many different alleles of a gene. Some genes may have as many as 3...

Q: 2. Genetic disorders of mitochondria are transmitted from_maternal inheritance female offsprings to ...

A: Introduction :- A pedigree is a genetic representation of a family tree that depicts the transmissio...

Q: What type of tissue is the heart made out of

A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...

Q: What is the underlying molecular mechanism of action for the antibiotic novobiocin?

A: Novibiocin is an antibiotic produced by the fungi belongs to actinomycete class which is Streptomyce...

Q: 1) What piece of evidence initially convinced Dr. Alvarez that a mass extinction had occurred at the...

A: Fossils are the geologically preserved remains of previously lived animals, plants, or other living ...

Q: Which of the following is true about the movement of ions across excitable living membranes?   Ions...

A: Introduction :- The thin layer that forms the outer edge of a living cell or a cell compartment with...

Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force) ...

A:

Q: A disease is known to be inherited through an ADHL mode of inheritance. For a pairing of two affecte...

A: Genetics provides information about different inheritance patterns: Autosomal dominant inheritance A...

Q: Describe the smaller and largest living unit of circulatory system

A: The smallest unit of the circulatory system:- Capillaries - Capillaries are the smallest functional ...

Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding dau...

A: DNA is molecule which is present inside a cell and contain the genetic information of an individual ...

Q: Problem 3. In a population of cattle, the frequency of allele R is .7 and of allele r is .3. Also, t...

A:  Frequency change due to mutation in different generation: Rt=R(1-m)t Rt=change in allele frequency ...

Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside tr...

A:

Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...

A: Generation 3 is.... 1. Dd 2, 3,4,5,6.. is dd Genotype.  

Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...

A: Insects are adapted their environment in many ways. An adaptation is an adjustment to the environmen...

Q: 1.What stage of mitosis would be the most likely to stall if there was an issue with the microtubule...

A: Mitosis: it occurs in haploid as well as in diploid cells. It is decided into many phases such as pr...

Q: (A) Explain clearly the developmental and evolutionary significance of the neural crest within the p...

A: Neural crest: it is found in vertebrates. Neural crest cells are derived from ectodermal layer of th...