Explain the mechanism by which action potentials are prevented from being propagated to a postsynaptic cell if transmitted across an inhibitory synapse.

Q: A. Tabulate your data. How commonly related the following species with each other? Monkey Mouse Rat…

A: The molecular sequence are frequently viewed as more dependable than those constructed from…

Q: Question 17 Match the following Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and…

A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Q: List two ways you think would minimise or avoid lag phase of microbial growth

A: During lag stage, the bacteria can adjust to development conditions. It is the period where the…

Q: Knockout mice are mice in which certain genes are rendered irreversibly nonfunctional through the…

A: The knockout mouse has been a valuable tool for geneticists to discern the role of a gene in…

Q: Food is a limiting factor for plants. A. TRUE B. FALSE

A: Living organisms can be classified into two types based on their mode of nutrition. 1. Autotrophs…

Q: The hemoglobin in mammalian blood is usually thought ofsimply as increasing the amount of O2 that…

A: Introduction :- Hemoglobin is a protein found in red blood cells that allows blood to transport…

Q: Ridge endings, Bifurcations, enclosures, and other ridge details are known as: Group of answer…

A: ANSWER;- Ridge characteristics Explain;- - Ridge characteristics are edge endings, bifurcations,…

Q: RNA polymerases used for the transcription of genes require an MRNA template * True false

A: Answer is true

Q: Charles Darwin once said, “It is not the strongest of the species that survive, nor the most…

A: This is a misquote with special reference to Charles Darwin regarding The Origin of Species in 1859.…

Q: 6. The following statements describe evolution EXCEPT: * A. Evolution is continuous B. Evolution…

A:

Q: 1. Where does energy enter the food web? 2. What happens to the Jackal population if the Lion…

A: This question comes from the food chain.it describe about a ecosystem food chain and ask when one is…

Q: Sketch a diagram to illustrate the interaction between MHC I molecules of the named cell type and…

A: The MHC I molecules are the major histocompatibility complex I which are present on the surface of…

Q: True or False: Based on the presentation by the State Anthropologist, the gender of a deceased child…

A: Anthropology is the study of human beings. It is the study which involves how human beings behave in…

Q: Outline the differences among the three most sophisticated lungsfound in modern animals: the…

A: The insect tracheal system is not dependent on the circulatory system in order to get the oxygen…

Q: Compare the overall body structure of the cave fish and the minnow below. cave fish minrow 1. What…

A: Cave fishes  These fishes are called so because they have adapted themselves to live in caves and…

Q: I. Identify the reactants, enzymes, cofactors/coenzymes and products involved in the glycolysis…

A: The entire number of biochemical processes involved in sustaining the living circumstances of cells…

Q: Describe a synaptic mechanism underlying the formation of memory.

A: Synaptic transmission allows neurons to interact with any type of cell that expresses receptors for…

Q: Related proteins that may be products of alternative splicing are often referred to as____.…

A: Alternative splicing is a process in gene expression that allows a single gene to code for multiple…

Q: Parent Cross: Blue-Eyed Male x Normal Female Blue-Eyed Female F1 Offspring Normal Male Normal Female…

A: Drosophila melanogaster. The position of the white eye gene, positioned at the x-chromosome of this…

Q: 1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible…

A: A limb is a jointed appendage in humans and numerous different animals use for locomotion like…

Q: Combining your knowledge of rates of diffusion with yourknowledge of muscle physiology, explain why…

A: Slow-twitch (Type I) fibres, which are characterised by muscles with lengthy contraction duration…

Q: Can you please make a conclusion for this? Thank you so much!   Suppose you counted 79 R_ and 33…

A: Mendel's monohybrid cross involves the mating between individuals with different traits for a single…

Q: Are there any safety concerns with teaching a cat in this way?

A: Learning is defined as any relatively permanent change in behaviour that occurs as a result of…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: All are stages in transcription EXCEPT: A chain termination. B DNase I activity on RNA…

A: Transcription is the process of conversion of RNA to proteins. It involves 3 steps initiation…

Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…

A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…

Q: The sequence of Arrival of insects to a body is: Group of answer choices Spiders, Ants and Wasps,…

A: *Insects grow by metamorphosis that means by undergoing changes like beetles, moths, butterflies,…

Q: Which of the following is NOT true concerning Transdeamination O Transamination forms glutamate in…

A: ANSWER;- All amino acids participate in transamination reactions. Explain;- All of the amino acids…

Q: 5. How are vestigial structures an example of evidence of evolution?

A: Here we describe the vestigial structures as an evidence of evolution.

Q: Describe the nature and extent of genetic variation, including genetic polymorphism, balanced…

A: There are basically three types of genetic variation. These are:   Single base-pair substitution –…

Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…

A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…

Q: Please give the following information about biopharmaceutical technology. Definition of…

A: Here we provide you the information regarding the future perspective, challenges, and examples of…

Q: Describe the white and gray matter regions of the cerebrum, cerebellum and spinal cord. Include in…

A: Introduction The Central Nervous System has two kinds of tissues termed grey matter and white…

Q: When you change your focus from near to a far object, describe the three main mechanisms occur in…

A: Introduction :- The human eye is a sense organ that responds to light to allow vision. Both the…

Q: A) Calculate the map distance separating the three genes B) Which gene is in the middle?

A: Symbol  white eyes = r short wings = l  ebony bodies = g    red eyes = R long wings = L  Gray bodies…

Q: What is the role of dynamin in recycling synaptic vesicles? What evidence supports this?

A: GTP bonding protein, also referred to as G protein. G protein is found in eukaryotic cells and is…

Q: You have now studied three different types of anatomical structures. Homologous structures show…

A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…

Q: Question 13 The absence of a sigma factor will never initiate transcription. A True B) False

A: Introduction:- The enzyme RNA polymerase copies a specific segment of DNA into RNA during…

Q: What is the final electron acceptor for anaerobic organisms?  What does this mean

A:

Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…

A: Since you've asked multiple questions, we're answering only the first three for you. If you want any…

Q: Monarch butterflies are a foul-tasting, poisonous species of butterfly. Monarchs feed almost…

A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…

Q: What is Binomial system of nomenclature? Who proposed this system? Why is binomial nomenclature the…

A: Binomial Nomenclature Carolus Linnaeus in the 1750s gave the formal naming system to organisms…

Q: Meiotic double strand breaks are repaired by SPO11. * True false

A: Meiotic recombination is the process of reciprocal exchange of genetic material (DNA) between the…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: *pheromones are chemicals released by an organism to external environment which takes specific…

Q: What important biological characteristics of life depend on mitotic cell division?

A: Cell division is a process that results in the development of two daughter cells is named Mitosis.…

Q: situation: a. How would your advice the survivors? b. How would your advice the families of the…

A: First I'll evaluate and identify the risk by trying a less risky option. And see preventing access…

Q: How does the concept of a stem cell differ between animal and plant systems?

A: A major difference that lies between plant stem cells as well as animal stem cells is that:  plant…

Q: Patients with sever ly reduced C3 levels tend to have а. Increased number of severe viral infections…

A: C3 means complement component is a protein present in the immune system. It is important for innate…

Q: You identify a new bacterial species in the koi pond between the Curry Student Center and Robinson…

A: NE koili bacterial genome contains cas gene & various bacteriophage genomes separated by unique…

Q: 11. Choose from the following types of inheritance and write in the 1" column which one is described…

A: Please follow step 2 for a detailed explanation of the inheritance mode of the given situations.