_snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These base pairs later are broken and it will replaced by_SNRNP * U2; U6 U2; U4 O U1; U4 O U1; U6 U2; U5
Q: Explain the relationship of osmosis to enzymatic browning in potatoes?
A: Osmosis is the process of diffusion of solvent from the region of low concentrations of solute towar...
Q: The DNA-binding proteins that recognize and accurately initiate transcription at specific eukaryotic...
A: * Response elements are short sequences of DNA within a gene promoter that bind specific transcripti...
Q: butterfly wing bird wing un What is the function of each of these structures? How are they different...
A: Analogous are comparable attributes shared by two unique creatures as a result of convergent develop...
Q: process of eukaryotic transcription in detail and mention the specific enzyme
A: Transcription can be defined as the process of copying genetic information from one strand of the DN...
Q: Karner blue caterpillars are: A protected by ants B fed by ants C attacked by a...
A: Mutualistic, commensalistic, or parasitic symbiosis is any sort of comprehensive and long ecological...
Q: How does developmental biology provide evidence of a common ancestry for vertebrates as diverse as r...
A: Evolution is a gradual change that occurs in populations. Mutation, genetic drift, natural selection...
Q: What are MHC class I and class II receptors and how do they recognize foreignness
A:
Q: An arctic hare's coat color changes from white to brown each spring in response to a change in its m...
A: Climate Change : Climate change refers to long-term shifts in temperatures and weather patterns. ...
Q: What two properties define a stem cell? Distinguish between a totipotent stem cell, a pluripotent st...
A: In the body, stem cells work as a repair system. Stem cells are cells having the ability to develop ...
Q: What are the relative merits of Drosophila, C. elegans, M. musculus, and Arabidopsis as model organi...
A: Model organisms are employed in research experiments to study a specific phenomenon where the result...
Q: Caspase proteins are enzymes known to play a role in programmed cell death (apoptosis) and the infl...
A: Caspase is the set of enzymes belonging to protease and they are responsible for the cell with progr...
Q: Which of the following is considered a synapomophy of the Kingdom Disciristatae? * It exhibits the t...
A: Evolution is defined as the process of change in allelic frequencies in a population over successive...
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity, eukaryoti...
A: RNA polymerase is an enzyme which is responsible for the transcription process, that takes place in ...
Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access ...
A: *To begin the transcription DNA duplex must be opened to allow the RNA polymerase to unwound segment...
Q: All are stages in transcription EXCEPT: A chain termination. B DNase I activity on RNA polymerase/DN...
A: Transcription is the process of conversion of RNA to proteins. It involves 3 steps initiation elimin...
Q: 1 Discuss the different types of connective tissues in animals
A: ANSWER) Tissues are the constituents of the body and are involved in supporting, protecting and giv...
Q: MULTIPLE CHOICE Question 10 Why is water along lakeshores and in rivers more vulnerable to thermal p...
A: Thermal pollution Thermal pollution is the change in the temparature of environment from natural te...
Q: State any five objectives of biological classification.
A: Introduction In this question we will discuss about the objectives of biological classification.
Q: Discuss the process of eukaryotic transcription in details please.
A: Transcription is a process in which RNA is synthesized from the template strand of DNA. Like any oth...
Q: Question:- Repeat photography can be used to detect and document long term ecological changes. C...
A: Ecology is the study of the interactions between organisms and their surroundings, whereas environme...
Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with...
A: According to the mendelian principle, the dominant characters is expressed and the recessive charact...
Q: Question 25 Which of the following is true re: oxygen saturation curves? Hemoglobin saturation curve...
A: Hemoglobin is a protein that binds to oxygen and carries it.
Q: Binomial expansion problem: The disease cystic fibrosis is a recessive disease governed by a single ...
A: Let's take the gene as C The parents are heterozygous and are unaffected but carriers. The genotype ...
Q: Compare the PATHWAYS, and ENERGY INPUTS and OUTPUTS of Aerobic Respiration and Fermentation in livin...
A: Aerobic respiration take place in the presence of oxygen however fermentation take place in the abse...
Q: Critical analysis on environmental pollution due to face masks
A: As everybody knows COVID-19 pandemic is contributing to the increased usage of face masks but using ...
Q: To collect blood from infant patient and you need low ? amount, Which source is good * Arterial Bloo...
A: The human body is made various organ system. All these organ systems perform different physiological...
Q: A bird has just observed a potential mate. In order for the mating ritual to begin, which of the fol...
A: The nervous system is divided into two parts: The brain and spinal cord together form the central n...
Q: In bacteria, single polycistronic MRNA encodes for:
A: This question is based on polycistron.
Q: What did genera discussed the Enterococcus? Are the healthcare concerns, infections, and nosocomial ...
A: DISCLAIMER "Since you have posted a question with multiple sub-parts, we will solve the first three ...
Q: Evolution is the accumulation of genetic changes within _______________ over time. (a) individuals (...
A: The biological change of a species over time is referred to as evolution. Evolution helps organisms ...
Q: Influenza vaccines must be changed yearly because the amino acid sequence of the viral proteins chan...
A: DISCLAIMER : Since you have asked multiple question, we will solve the first question for you. If yo...
Q: True or False: Based on the presentation by the State Anthropologist, the gender of a deceased child...
A: Anthropology is the study of human beings. It is the study which involves how human beings behave in...
Q: Which answer below best describes a TRUE statement of the organisms in the food web shown below? Rac...
A: Introduction All organisms on the earth need energy for their primary support of life. The energy re...
Q: Which complement chemotactic component has properties? а. Cla с. C4a d. C5a b. C2a е. Сба
A:
Q: How is Aristotle’s “scale of nature” idea linked to early evolutionary thought? In what ways does it...
A: Evolutionary theory of biology states that organisms undergo a change in successive generations over...
Q: Overall, meiosis and mitosis are analogous processes involving many of the same proteins. However, s...
A: Meiosis and mitosis are the two types of cell divisions.
Q: How does lupine affect the range of the Karner Blue butterfly? A Lupine displaces Karner Blue host ...
A: The scientific name of Karner blue butterfly is the Lycaeides melissa.It belongs to class insecta in...
Q: Match each of the statements below with the fibrous protein that mostly fits the description. Coiled...
A: Keratin is a hard protein compound present in the epidermis, hair, and nails that aids in the preven...
Q: name of the cellular receptor that hemagglutinin binds to ?How does Influenza enter the cell once it...
A: Influenza Is a viral infection that targets the respiratory tract of humans (mainly the nose, throat...
Q: Instructions: Answer the following problem using the punett square and identify its Genotypic ratio ...
A: Phenotype: A phenotype is a set of observable features or attributes of an organism in genetics. Th...
Q: All may be RNA polymerase Il promoter constituents EXCEPT: (A a TATA box upstream the transcription ...
A: * promoter is sequence of DNA where proteins binds initiate transcription of RNA from DNA downstream...
Q: Describe the series of events by which APC/C promotes the separation of sister chromatids at anaphas...
A: Anaphase promoting complex has a tendency to promote the transition of chromosomes that come from me...
Q: A. from eagles to rabbits B. From weasels to eagles C. From rabbits to green plants D. From weasels ...
A: The ecological pyramids show the transfer of energy and matter in the form of food from one populati...
Q: How do eukaryotic and prokaryotic RNA polymerases compare? Eukaryotic and prokaryotic RNA polymer...
A: Prokaryotes have only one RNA Polymerase, while eukaryotes have three (RNA Polymerases I, which tran...
Q: we read that in tumor cells Rb protein is hyperphosphorylated. In response to that, will p53 level i...
A: Phosphorylation leads to interdomain locking, which alters the structure of pRb and inhibits it from...
Q: An epidemic may be detected by observing
A: Endemic is used to describe diseases that spreads rapidly to a large number of people of a given pop...
Q: What important biological characteristics of life depend on mitotic cell division?
A: Cell division is a process that results in the development of two daughter cells is named Mitosis. T...
Q: You identify a new bacterial species in the koi pond between the Curry Student Center and Robinson H...
A: NE koili bacterial genome contains cas gene & various bacteriophage genomes separated by unique ...
Q: Discuss the relationship between cancer and changes in gene expression that affect cell developmenta...
A: Cancer is the condition in which the control over the process of cell division is lost.
Q: Mammals have brains that are more complex than those offish and amphibians, particularly in terms of...
A: The brain is the mass of nerve tissue at the front end of an organism. The brain integrates sensory ...
Step by step
Solved in 2 steps
- How many Fnu4H1 sites do you find in this sequence? (in other words, how many times will this enzyme cut this sequence?) Reminder Fnu4H1 recognition site is: 5'-GC*NGC-3'3'-CGN*CG-5' The * indicates the cut site and N indicates any nucleotide. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGCGiven the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition; transversion; silent; missense; nonsense; frameshift mutations;
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC
- Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′Which of the following statements is true?a) Exonuclease III removes nucleotide residues from the 3’ ends of a DNA strandb) Bacteriophage lambda exonuclease removes terminal phosphatesc) Alkaline phosphatase removes nucleotides from 5‘endsd) Kinase adds homopolymer tails to the 3’ –OH ends of a linear duplexTAG CCG ATA GCT TGA Translate the gene above into a protein . Please write the three letter code of the third amino acid in the sequence in the blank.
- Choose your choice of 5 amino acidsDon't forget - the start code and the stop code Put them in the order you wantwrite their codon (from the table below - this represents your mRNA) and their initial (which represents amino acid) At this moment, you create from this message, the DNA triples (reminder: A, T, C, G) by making the complement Then, from this message, you create the tRNA anticodons (reminder: A, U, C, G) by making the complement (arrêt=stop and depart= start) please I need all the steps, thank you! :)GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'The following sequence represents the template DNA from a portion of a bacterial gene: GGC TAG ACT CAT ATC GGG. What would the sequence of the complementary DNA strand, mRNA, and protein be?