Explain why the genetic code is said to be redundant and virtually universal, and discuss how these features may reflect its evolutionary history.

Q: How are grasslands classified?

A: In this question we will discuss about how grasslands are classified.  

Q: In your own understanding, Indentify the hurdles that may help to lengthen the shelf-life of squash ...

A: The shelf- life of a product depends upon the condition in which the product is being placed. Better...

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: Tay–Sachs disease is caused by recessive alleles on anautosome. In which case(s) could two parents w...

A: Dominant allele is one that always expresses its phenotype. Recessive allele is one that is expresse...

Q: The two categories of stem cells in the human body are embryonic stem cells and adult stem cells. Th...

A: All the the answer choices are correct.

Q: As global average temperature increases, which of the following regions is expected to experience th...

A: Global warming is a phenomenon in which the earth's global temperature is increased due to the emiss...

Q: How do we know that members of the human lineage used to have an opposable toe on their foot?

A: There was a fossil discovered some years back in Ethiopia which led us to draw a conclusion that hum...

Q: Muscle fatigue has been suggested as one factor that can increase the chances of non-contact sports ...

A:  * Anterior cruciate ligaments found inside knee joint.which cross each other to form an "X"  shaped...

Q: The junctions between one neuron and another neuron are called dendrite Oon O myelin sheath 3 oel bo...

A: Neurons/nerve cells are the structural and functional unit of the nervous system. A neuron consists ...

Q: Compare the developmental stages (cleavage, blastula, gastrula) of the frog with an invertebrate pre...

A: INTRODUCTION Different stages of development of frog and sea urchin is given below.

Q: A trait that is exclusive to a group of animals but different from what their ancestor had is called...

A: Traits are evolved for many reasons including the survival, reproduction, food availability and many...

Q: 45

A: Steps of Enchondral Ossification Cartilage > Bone Detailed sequence elucidated in part 2

Q: There are two figures- one for vector control plate & another PCRinsert+vector experimental plate.  ...

A: We know that genetic selection of transformed or transfected cells is one of the significant step of...

Q: Suppose you had to design a hypothetical drug for Alzheimer's disease. Which of the following best d...

A: ANSWER;- C.)  A drug that increases the level of APP protein in the neuron. It is a very effective ...

Q: What factor could have been responsible for the changes in the population's age structure? Use the s...

A: The population age structure of a country or region is the distribution of its people's ages. This c...

Q: Explain the terms "methylase," "methylates" and "methylation"

A: METHYLASE:- A methylase is the enzyme that recognizes a specific sequence and methylates one of the ...

Q: Write 5 uses of a cladogram (unscaled tree).

A: Cladogram  It is a branching tree diagram showing shared morphological traits between species.

Q: Why is leguminous crop rotation used in agriculture?

A:

Q: How are enzymes classified? What are the different classes of enzymes?

A: Enzymes are biocatalyst that is proteinaceous in nature and perform a specific type of chemical reac...

Q: Over time, Lizard tails have become shorter than the longest tail but longer than the shortest tail,...

A: Selection in evolution is the process by which heritable traits become more or less common in a popu...

Q: Provide a description on the plant cell of the Hydrilla leaves viewed on a microscope with high powe...

A: Answer : Hydrilla is a type of aquatic plant which are the submerged in water.  They functions as th...

Q: Give the Morphological characteristics of Aedes aegypti adults.

A: Toxorhynchitinae, Anophelinae, and Culicidae are the three subfamilies of the Culicidae family, with...

Q: Can the amount of available energy on a given trophic level be larger than the available energy on l...

A: The number of steps an organism has taken from the beginning of the food chain determines its trophi...

Q: A researcher crosses two white-flowered lines ofAntirrhinum plants as follows and obtains the follow...

A: Introduction  Sir Gregor Mendel is known as the Father of Genetics. He was the pioneer scientist who...

Q: Q6.10. For a population containing 80 females and 20 males, what is the effective population size, N...

A: Introduction:- One of the most significant parameters in population genetics and conservation biolog...

Q: in your own words,  describe the squash soup in terms of appearance, color, size, shape, texture (fi...

A: Squash soup is made from a wide varieties of squash which provides it a appetizing flavor. Along wit...

Q: Which of the following statements does NOT describe Darwin's theory of natural selection  A. Member...

A: * Natural selection is the mechanism in populations of living organisms adapt and survive best. *Spe...

Q: lungs

A: Answer  Correct option is C  Lungs 

Q: 5

A: Recombinant forms of Oestrogen and Progesterone are used in post menopausal women. Recombinant insul...

Q: Aside from Dengue Fever what other diseases can Aedes aegypti carry? Give 3

A: Classification Kingdom : Animalia Phylum.   : Arthropoda Class.      : Insecta Order.       : Dipter...

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...

Q: Which of the following statements about the differential expression of human genes is correct? A. D...

A: The Human Genome Project states that genes in human vary greatly in size, ranging from a hundred DNA...

Q: The bottom-up hypothesis states that snowshoe hare populations in northern Canada a. are limited by ...

A: DISCLAIMER : Since you have asked multiple question, we will solve the first question for you. If yo...

Q: If  I extract a cell culture with 100 cells that just entered g1.  I needs to extract the MOST possi...

A: Introduction: Cell cycle is the process by which a cell replicates i.e. makes copies of itself or fo...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: * Electron transport chain are sequential process of reactions occurs in mitonchondrial innermbrane ...

Q: What is the importance of water, carbon and nitrogen for living organisms? Explain briefly.

A: Importance of water for living organisms:-  All animals and plants need water to survive, and the hu...

Q: 22

A: Motor neurons are components of peripheral nervous system which conduct efferent impulses from the s...

Q: 3. Identify the IMVIG pattern of the following tubes. For set of tubes that is E. coli positive, ide...

A: IMViC test are individual four tests that is - indole test methyl red test voges-proskauer test &amp...

Q: Can the amount of available energy on a given trophic level be larger than the available energy on l...

A: The statement is wrong . The avelable on lower tropical level is always higher than at higher tropic...

Q: O proprioceptor O photoreceptor O mechanoreceptor O chemoreceptor

A:

Q: Explain the translation with its stages.

A: All cells use replication, transcription, and translation to keep track of their genetic material an...

Q: Match the fossil hominin with is most accurate description; not all hominids will be used.   Questi...

A: Fossil hominids: these are the extinct ancestors of genus Homo. 

Q: One of the most common ways to get protozoa for microscopic inspection is by hay infusion. What make...

A: Hay infusion is a method used for growing of protozoa for microscopic inspection. 

Q: Repolarization occurs because Multiple Choice more sodium ions diffuse into the cell than potassium ...

A: At the resting stage, the Na+ and K+ channels remain closed.

Q: Most flour beetles are black, but several color variants are known. Crosses of pure-breeding parents...

A: Introduction The first filial generation is the F1 generation, and the second filial generation is t...

Q: In the experiment of cell fusion, when tumor cells were fused with normal cells, the initially forme...

A: Cell fusion is an important cellular process in which two or more uninucleate cells merge to form a ...

Q: Which among the processes below will be used during heat defense? vasodilation and thermogenesis O s...

A: vasodilation work against heat as sweating does  When heat produce in body to balance the body tempe...

Q: You are spending a summer in Austria following up on some of Mendel's work. You are studying the inh...

A: Let the allele causing colour be R/r Hence, genotypes of Red colour (dominant):- RR, Rr Genotypes of...

Q: Both rhodopsin in vision and the muscarinic acetylcholine receptor in cardiac muscle are coupled to ...

A: Receptors receive the signaling molecules that bind to them.  

Q: Another name for fiber is amylose O cellulose O pectins O Amylopectin

A: all plant fibers are constructed by few constituents such as cellulose, hemicelluloses, and lignin, ...

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.