Answered: Fatty fish like salmon reduce the risk…

Fatty fish like salmon reduce the risk of heart diseases because they are high in which reduces blood clotting and inflammation

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter39: Digestion And Nutrition

Section: Chapter Questions

Problem 12SQ: _______ is (are) a good source of omega-3 fatty acids that can reduce the risk of heart disease. a....

See similar textbooks

Related questions

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of DNA is unique to all individuals. ...

Q: nucleoid ribosomes plasma membrane flagella lysosome mitochondria nucleolus prokaryotic only eukaryo...

A: Prokaryotic and eukaryotic cell share few similarities however show so many difference in their stru...

Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...

A: Introduction: Hyperkalemia is a condition of high potassium levels in blood.

Q: Which of the following statements concerning T cell development is correct? A. Progenitor T ...

A: * T cell are part of the immune system from which they develop from stem cells in the bone marrow. ...

Q: Give the importance of the following factors in bacterial characterization methods: (a) cultures, (b...

A: A microbe is a living entity that is so tiny that it cannot be seen with the naked eye. Microbiology...

Q: QUESTION 2 Cotransporters... UA Do NOT hydrolyze ATP UB: Include symporters that move ions in the sa...

A: Co-transporters are the membrane carrier proteins comes under secondary active transport of substanc...

Q: What are the 3 phase of the routine stool examination? 2. What would be the pre-analytical phase i...

A: Human feces is known as stool.It is the waste residue of indigestible materials of an animal's diges...

Q: Analyze the provided hypothetical neuronal set-up and its corresponding table which describes each n...

A: Nerve impulses are the key to the brain. They allow neuron to communicate with each other to deliver...

Q: The role of creatine phosphate in muscle cells is to: provide energy for muscles during extended phy...

A: Creatine phosphate serves as an “energy buffer” in muscle it is a high-energy, phosphorylated, nitro...

Q: How Would You Farm?

A: Farming is the practice of growing crops or raising cattle in a large area. It involves strong inter...

Q: Describe the scope of human population growth

A: Population growth is the increased number of humans in the world. Most of the human history shows th...

Q: The drug butenamide blocks the co-transporters for Na+ and Cl- in the ascending limb of the loop of ...

A: The drug butenamide is a loop diuretic whose main function is to block the Na+ k+ 2cl- co transport...

Q: What are three behaviorally measured outcomes of attention?

A: Three behaviorally measured outcomes of attention are: Improves response to objects. Affects Percep...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: What is a selective sweep? O When a beneficial mutation is lost due to genetic drift. O When a benef...

A: Certain terms are fundamental concepts in biology, the study of living organisms. Theses terms are s...

Q: write a short description to explain the morphology of graphide, styloid , prism , druse and crystal...

A: The above-mentioned terms infer the different shapes of Calcium oxalate crystals that are widely fou...

Q: What is the total fertility rate (TFR)? Why is the replacement fertility for humans approximately 2....

A: Introduction A population is the smallest unit of any ecosystem which collectively includes the ind...

Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...

A: The correct Answer is C

Q: Describe the mechanism of blood clohing

A: Blood clotting or coagulation is a process of forming blood clots to stop excess blood flow during c...

Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...

A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...

Q: what is sumoylation and how does it affects newly synthesized proteins?

A: SUMO proteins (Small Ubiquitin-like Modifiers) are a family of small proteins that are covalently at...

Q: in your own words, describe how genetic diversity makes a population resilient to environmental chan...

A: Genetic diversity is defined as the potential to resist a number of epidemics as well as diseases. G...

Q: If the a and b loci are 40 cM apart and an AABB and aabb individual mate: What gametes will the F1 i...

A: The recombinants means the individual form by combination of two different alleles other than parent...

Q: How does the translated mRNA convert into a functional protein?

A: Translation is a process in which cells make the proteins.

Q: Transmission of a nerve impulse across a gap between neurons is due to: a) Movement of a molecule, a...

A: Transmission of nerve impulse takes place jn brain as a result of stimuli. They are transmitted from...

Q: B. Female (Swine) 12 10 Urinary Bladder 13 Urinary Bladder 15 14 13

A: 9) Ovary 10) Oviduct 11) Uterine horn

Q: Describe what would happen to the precursor of a mitochondrial matrix protein in the following types...

A: Introduction Mitochondria are biological organelles found in vast quantities in most cells that perf...

Q: Much of our understanding of ATP synthase is derived from research on aerobic bacteria. What makes t...

A: ATP synthase is a mitochondrial enzyme that catalyzes the conversion of ADP and inorganic phosphate ...

Q: Distinguish sister chromatids from homologous chromosomes.

A: Homologous Chromosomes Diploid cells have two sets of chromosomes, which are referred to as homolog...

Q: y an ancestral trait and

Q: A phylogenetic tree is a branching diagram that shows the evolutionary relationship among different ...

A: Evolution Evolution is the natural process where organisms keep changing according to the environme...

Q: Analyze the following experiment and answer the questions that follow. Suppose that the growth behav...

A: Aquaculture is one of the leading animal-based food production sector in many of the countries. To o...

Q: Cytoplasm of a plant cell divides by the process of_____ . a. telekinesis c. fission b. nuclear divi...

A: Introduction Cytoplasm is a viscous liquid that fills each cell and is surrounded by the cell membra...

Q: Aside from Sanger Sequencing, what are the other DNA sequencing methods that are available today? Se...

A: Sanger sequencing is a DNA sequencing technology that uses electrophoresis and is based on DNA polym...

Q: It takes cycles of the Calvin cycle to form 1 glucose molecule.

A: Calvin cycle also known as carbon-fixation cycle or C3 cycle, is a series of biochemical reactions t...

Q: Give examples to the following questions, then make a cladogram using your answers. 1. Canine (Dog) ...

A: 1. Canines ( dog) A - domestic dog ; B - foxes ; C - wolves 2. Land animals A- Canines ; B- Felis ; ...

Q: Match each term with its best description. ___ cell plate a. lump of abnormal cel...

A: Introduction When a parent cell divides into two or more daughter cells, it is known as cell divisio...

Q: 3. Describe the effect of malaria on the frequency of the Hbs allele in areas where is common in are...

A: Sickel cell anemia is a genetic disease in which the RBCs present in the blood changes its shape fro...

Q: Describe the relationship between telomeres and senescence.

A: Chromosomes are the linear structures present during cell division.

Q: Explain the arm abduction and adduction at the shoulder joint together with the respective muscles i...

A: Movements in general at synovial joints are divided into four main categories i.e Gliding movement, ...

Q: A can cleave the hinge of each heavy chain as shown below.

A: IgG is cleaved with a protease that is the one which targets the hinge region. Proteolytic cleavage...

Q: if a parent cell with a diploid number of 12 or two divide by meiosis each daughter cell would have ...

A: Introduction: The production of offspring by sexual reproduction includes the fusion of two gametes,...

Q: The compound 2,4-dinitrophenol (DNP), which was used in diet pills in the 1930s but later shown to h...

A: Mitochondria is a site for aerobic phases of cellular respiration in cells.

Q: How biodiversity reflected the environment?

A: Introduction: Biodiversity means the diversity of life forms. It is a word commonly used to refer to...

Q: Question 4 All of the following are true about eyes EXCEPT O Each cone cell attaches to one connecti...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: back ground study of ampalaya

A: Introduction: Ampalaya is also known as Momordica charantia found in the tropical regions of the wor...

Q: 1. In humans, the allele for normal blood clotting, H, is dominant to the allele for hemophilia, h. ...

A: Introduction: Haemophilia is an inherited genetic disorder that impairs the body's ability to promot...

Q: What kind of domain is involved with intracellular signaling, cytoskeleton remodeling, and are able ...

A: Pleckstrin homology domain is a protein domain consisting approximately 120 amino acids.

Q: in humans the condition for normal blood clotting dominates hemophilia these genes are x linked if a...

A: "ANSWER The sex chromosomes of the father are designated XY, with the X chromosome bearing the haem...

Q: MAJOR differences in the inflammatory processes which have occurred in your uncle's lungs (he worked...

A: Asbestos: it is along with term disease in the lungs where a scar-like structure is formed on the lu...

Question

100%

Fatty fish like salmon reduce the risk of heart diseases because they are high in which reduces blood clotting and inflammation.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

_______ is (are) a good source of omega-3 fatty acids that can reduce the risk of heart disease. a. Oatmeal b. Legumes c. Fish d. Com syrup
Effects of Dietary Fats on Lipoprotein Levels Cholesterol that is made by the liver or that enters the body from food does not dissolve in blood, so it is carried through the bloodstream by lipoproteins. Low-density lipoprotein (LDL) carries cholesterol to body tissues such as artery walls, where it can form deposits associated with cardiovascular disease. Thus, LDL is often called bad cholesterol. Highdensity lipoprotein (HDL) carries cholesterol away from tissues to the liver for disposal, so HDL is often called good cholesterol. In 1990, Ronald Mensink and Martijn Katan published a study that tested the effects of different dietary fats on blood lipoprotein levels. Their results are shown in Figure 2.23. In which group was the level of LDL (bad cholesterol) highest?
Effects of Dietary Fats on Lipoprotein Levels Cholesterol that is made by the liver or that enters the body from food does not dissolve in blood, so it is carried through the bloodstream by lipoproteins. Low-density lipoprotein (LDL) carries cholesterol to body tissues such as artery walls, where it can form deposits associated with cardiovascular disease. Thus, LDL is often called bad cholesterol. Highdensity lipoprotein (HDL) carries cholesterol away from tissues to the liver for disposal, so HDL is often called good cholesterol. In 1990, Ronald Mensink and Martijn Katan published a study that tested the effects of different dietary fats on blood lipoprotein levels. Their results are shown in Figure 2.23. Figure 2.23 Effect of diet on lipoprotein levels. Researchers placed 59 men and women on a diet in which 10 percent of their daily energy intake consisted of cis fatty acids, trans fatty acids, or saturated fats. Blood LDL and HDL levels were measured after three weeks on the diet; averaged results are shown in mg/dL (milligrams per deciliter of blood). All subjects were tested on each of the diets. The ratio of LDL to HDL is also shown. Source, Mensink RP, Katan MB, Effect of dietary trans fatty acids on high-density and low-density lipoprotein cholesterol levels in healthy subjects. NEJM 323(7):43945. An elevated risk of heart disease has been correlated with increasing LDL-to-HDL ratios. Rank the three diets according to their predicted effect on cardiovascular health.
True of False: Fatty acids are converted to blood sugar during starvation.
The largest storage site for Vitamin A in the body is the __________________ fat cells brain liver pancreas
Consuming carbohydrates can lead to weight gain, and thus, they should make up a very small percentage of your daily intake. is this true or false
Amino acids that must be provided in the diet are called_________________________ amino acids
Out of the following, cholesterol does not serve as a precursor for which compounds?a) Vitamin Db) Sex hormonesc) Bile saltsd) Bile pigments
Acetoacetate is mostly formed from fatty acids in the: Adipocytes Intestinal epithelia Neurocytes Hepatocytes Myocytes