Fill in the blanks:In electrophoresis, an electric current is applied to the matrix of a gel-like substance known as agarose, in which the DNAfragments are placed. DNA is _ charged and will move from the_ electrode (black) to theand buffer.electrode (red) at the pH pf the gelSelect an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.apositively; positive; negativebnegatively; positive; negativepositively; negative; positivednegatively; negative; positive

Gel electrophoresis is a technique that is utenly used in molecular biology laboratories. It…

Fill in the blanks: In electrophoresis, an electric current is applied to the matrix of a gel-like substance known as agarose, in which the DNA fragments are placed. DNA is_charged and will move from the_ electrode (black) to the electrode (red) at the pH pf the gel and buffer. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. positively; positive; negative b negatively; positive; negative positively; negative; positive d negatively; negative; positive

Fill in the blanks: In electrophoresis, an electric current is applied to the matrix of a gel-like substance known as agarose, in which the DNA fragments are placed. DNA is_charged and will move from the_ electrode (black) to the electrode (red) at the pH pf the gel and buffer. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. positively; positive; negative b negatively; positive; negative positively; negative; positive d negatively; negative; positive

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 9QP

See similar textbooks

Similar questions

These are the questions choices are given below (i) What is the purpose of adding table salt (NaCl) to the DNA extraction buffer (ii)If ______ alcohol is added to water, the two solutions are ______, forming a ______solution. If ______ alcohol is added to a salted water solution, the two solutions become ______, forming a ______ solution
Based on your gel, how big are the DNA fragments in each lane? Enter your results in Table 2.
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Visually compare the intensity of your team’s Plant-DNA sample with the intensity of the 3 kb band on the DNA ladder (see figure posted below). For example, if your Plant- DNA sample closely matches the 3 Kb band, this represents approximately 125 ng of total DNA. Divide the approximate mass (ng) of DNA in your sample by the volume loaded in the gel minus the loading dye added (i.e., 12 – 2 = 10 μL, since you loaded 12 μL from a 24 μL sample that contained 20 μL DNA prep + 4 μL loading dye. What is the DNA concentration of your sample? ______ng/μL
In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to measure DNA, and _______ to measure protein. The ratio _______ is then calculated, and a number between _______ indicates higher purity. 280 nm; 260 nm; A280/A260; 0.5-1 260 nm; 280 nm; A260/A280; 0.5-1 260 nm; 280 nm; A260/A280; 1.5-2 260 nm; 280 nm; A280/A260; 1.5-2
In lane 1, a size standard was loaded, which contained a mix a DNA fragments known to be 1000 bp, 700 bp, 500 bp, 200 bp, and 100 bp. When the gel was run and stained, the following photograph of the gel was taken. Click directly on the band in lane 1 that represents the DNA fragment that is 500 bp in size.
A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in greater detail (in the same orientation as they would occur in the ladder model). Which two nucleotides did the student draw?
Please check the pic. Find out where the divisions between fragments are , the number of fragments and the base pairs in each fragment for DNA 1,2,3. Thanks
What enzyme proofreads the DNA molecule? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase III
Consider the problem of searching for genes in DNA sequences using Hor-spool’s algorithm. ADNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern. a. Construct the shift table for the following gene segment of your chromo-some 10: TCCTATTCTT b. Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT