In lane 1, a size standard was loaded, which contained a mix a DNA fragments known to be 1000 bp, 700 bp, 500 bp, 200 bp, and 100 bp.  When the gel was run and stained, the following photograph of the gel was taken. Click directly on the band in lane 1 that represents the DNA fragment that is 500 bp in size.

Q: A circular DNA of 40 kb (40,000 bases) length is cut with a restriction enzyme whose precise…

A: The probability of a restriction enzyme to be found in a DNA is 4n, where n is the number of bases…

Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…

A:

Q: In this diagram representing the steps of PCR (Polymerase Chain Reaction), yhich letter represents…

A: When DNA is heated to 95 degree Celsius denaturation of DNA occurs .

Q: What allows the peaks to be different colors?

A: DNA sequencing refers to the determination of the nucleotide sequence in the DNA molecule. Automated…

Q: A cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of…

A: Sanger sequencing, often called chain-termination sequencing, is a DNA sequencing technology…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…

A: Gel electrophoresis is the technique for the separation of DNA fragments on the basis of size and…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: samples Marker B 1,200 bp 1,000 bp 900 bp 800 bp 700 bp 600 bp s00 bp 400 bp 300 bp 200 bp 100 bp…

A: The given diagram is a representation of the process of gel electrophoresis. It is a laboratory…

Q: Which of the following is most needed to determine the DNA quantity using the eyeball method? A DNA…

A: DNA quantity was determined by several methods where absorbance was one of the widely used methods…

Q: During proofreading, which of the following enzymes reads the DNA? a. primase b. topoisomerase c.…

A: BASIC INFORMATION  DNA  it stands for deoxyribo nucleic acid.  it is the genetic material of all…

Q: Which of the following ingredients does not belong in a sequencing reaction? ddNTPs Primer © Ligase…

A: Sequencing of DNA  The technique to know the exact order of base pairs (nucleotide) in a DNA.

Q: ripe banana a better sample compared to an unripe banana for DNA extraction

A: Raw bananas are often preferred for DNA extraction because they have high number of cells per…

Q: Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how…

A: The answer to the first question is, 3 grams of agarose in 150 ml of TBE.   *to get the second…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…

Q: Select all the following statements that are correct regarding agarose gel electrophoresis and…

A: Agarose gel electrophoresis is a process used for separation of DNA fragments. Steps of agarose gel…

Q: Put the following pieces of DNA in order that they would appear reading from the top (nearest the…

A: First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…

Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…

A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…

Q: Can you please interpret and discuss and mark, this gel electrophoresis results.  DNA ladder sizes:…

A: A molecular-weight/ size marker, also referred to as a DNA ladder, is a set of standards that are…

Q: What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis…

A: Sanger sequencing method is chain terminating method.

Q: how enzymes are involved with proofreading newly formed DNA molecules.   1. DNA polymerase does not…

A: In proofreading process, The polymerase checks whether the recently added base has matched…

Q: As a scientist in Company X, your manager asks you to design a methodology to separate the three DNA…

A: DNA sequencing is a process of determining the sequence of nucleotide bases in a piece of a DNA .…

Q: The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a…

A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecules from nucleoside…

Q: A DNA sample was sent off for Sanger sequencing. The results are shown below. What is the sequence…

A: The Sanger sequencing is also known as the chain termination method, it is a method used to…

Q: See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut…

A: An enzyme derived from bacteria that cuts DNA molecules at specified sequences is known as a…

Q: Someone broke into the bookstore and stole thousands of dollars’ worth of textbooks. Some hairs were…

A: Most likely the culprit is suspect 1. This is so as the banding pattern of suspect 1 is matching…

Q: Three pieces of cut DNA were isolated using gel electrophoresis.The DNA that is the longest will be…

A: At first, let's see what is gel electrophoresis? Actually, gel electrophoresis is a type of…

Q: The diagram shows an autoradiograph of a DNA sequencing gel. What is the 5' to 3' sequence of the…

A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…

Q: hematic diagram for the procedure in doing DNA extraction, isolation and quantification

A: The deoxyribonucleic acid isolation method frees deoxyribonucleic acid from the cell and {so}…

Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…

A: A restriction enzyme, also known as a restriction endonuclease, is a bacterial protein that cleaves…

Q: State the function of each chemical/components below in DNA extraction    Salt:  Detergent:…

A: Breaking cells open to release the DNA.  Separating DNA from proteins and other cellular debris.…

Q: After the students identified the correct model, they did additional research on how DNADNA is…

A: DNA replication is the process by which double-stranded DNA is unwinded to produce two daughter…

Q: DNA could be denatured without maximum damages a. NaCl b. High heat c. NaOH d. Na-acetate

A: The process of separation of double stranded DNA (dsDNA) into single strands by physical or chemical…

Q: A circular DNA molecule is subjected to complete restriction digestion by (1) BamHI alone, (2)…

A: Restriction enzymes cut DNA at a specific location called as restriction site.

Q: The gel profile has plasmid DNA digested by different restriction enzymes in lanes 1 to 4 (left to…

A: First option is incorrect because in the given diagram of plasmid DNA gel profile the DNAs in lanes…

Q: Which of the following is the correct order in extracting the DNA?   I. Washing of DNA II. Tissue…

A: DNA act as genetic material in most of organism . It is two stranded , ladder like structure . DNA…

Q: DNA bands from each sample lane of the gel electropherogram below.

A: Key points: Gel electrophoresis is a technique used to separate DNA fragments according to their…

Q: How we prepared the sample of DNA and what kinds of tracking dye we add to sample in SDS-PAGE ?…

A: INTRODUCTION SDS PAGE or Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis is a technique…

Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…

A: The process of indexing a genome is similar to that of indexing a book.

Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…

A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…

Q: In order to complete the strand on the left, the following are needed: DNA polymerase [Select]

A: DNA replication is very important and critical process taking place in all living cells in their S…

Q: L 1 2 3 Locus A Locus B L = Standard marker 1 = Suspect 1 2 = Suspect 2 3 = DNA from crime scene

A: In biotechnology different techniques have been used for the identification of DNA among different…

Q: The rate of migration of DNA within an agarose gel in the gel electrophoresis technique is dependent…

A: Agarose gel electrophoresis: It is used for the separation of DNA molecules that are larger than…

Q: Wells Base pairs: 6650 4973 4.3cm 3148 2396 1585 8 Ocm 692 > 10 Acm DNA size Markers Vector-EcoRI…

A: Hi, Thanks For Your Question.  Answer : First, Let Us See The Ladder Size. Let's Do Rounding Off…

Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…

A: The answer is 100 kb .

Q: If insert DNA was obtained by PCR using Taq DNA polymerase, what shape does the end of this DNA…

A: Taq polymerase is basically a thermostable polymerase that is obtained from the bacteria called as…

Q: Using the gel image: the three brightest fragments in the ladder are 100 bp, 500 bp, and 1000 bp in…

A: The gel electrophoresis is a method used to separate different fragments of DNA on the basis of…

Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…

A: The correct option is b 5'CCATTGG3'. Sanger sequencing ( method of DNA sequencing and it involves…

Crime Scene Investigation

A crime scene refers to a place where a crime has occurred. The purpose of crime scene investigation (CSI) is to analyze the complete scene and catch the culprit based on the pieces of evidence collected from the place of crime. The people involved in this process are referred to as crime scene investigators.