From DNA to Protein and Inheritance Co-Dominance: In co-dominance, the heterozygous individual exhibits the phenotype for both alleles. We used the ABO blood groups as an example of co-dominance. 8. What potential blood types can be present in the offspring if two type "O" mate with one another? parents

Q: 7. DNA generally forms a double stranded helix. If a single stranded DNA has a nucleotide sequence…

A: A DNA has two strands and each strand composed of 4 types of nucleotides (adenine, guanine, cytosine…

Q: Rarely, both sister chromatids of a replicated chromosome end up in one daughter cell. How might…

A: Mitosis is a cell division in which one mother cell will divides into two new daughter cells which…

Q: What is the signifificance of determining the urine's specific gravity Compare and contrast…

A: A set of tests performed on the urine, or pee, are called a urinalysis. It is used by physicians to…

Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG

A: The initial stage of gene expression, transcription, uses information from a gene to build a…

Q: A researcher engineers a lac operon on a plasmid but inactivates all parts of the lac operator…

A: Operon is the gene regulatory mechanism in prokaryotic organisms that regulate the production of…

Q: Researchers have discovered that during replication of the circular DNA chromosome of the animal…

A: DNA replication is the production of new DNA from the old DNA molecule that occurs in…

Q: 1. In guinea pig, fur color is determined by one gene, and fur length by another independently…

A: Dominant traits are always expressed even if only one copy of the dominant trait exists. Recessive…

Q: Describe one advantage and one disadvantage of ASEXUAL reproduction.

A: Paramecium, sometimes known as Paramoecium, is a genus of "ciliated unicellular protozoa." They live…

Q: Give examples of antibiotics, their mode of action, target microorganism, and classify where they…

A: antibiotic is a chemical compound that is toxic to other bacteria and is generated by a living…

Q: Draw a diagram/flowchart and describe in detail the process of normal clot formation AND breakdown,…

A: The understanding of the blood coagulation system has advanced recently in anesthetic practice.…

Q: How does salt, ph, UV light, hypertonic conditions affects the growth of microorganisms?

A: The environment has a significant impact on the growth of microorganisms. Microorganisms are…

Q: If they Millepied has 20 segments, how many legs would have

A: Millipedes are a type of arthropod that have long, segmented bodies and many legs. They are usually…

Q: P₁0 ORF1 t₁ ORF2 ORF3 t₂ The diagram above illustrates an operon that is regulated by the RepR…

A: An operon is a group of genes and the regulatory elements that regulate the expression of those…

Q: As oxygen consumption and cardiac output increase during exercise, the pulmonary diastolic pressure…

A: Cardiac output is the volume of blood the heart pumps each minute, is the process through which…

Q: Do not copy here in Google or Bartleby. QUESTION 1. In tabular form, what are any differences…

A: A seed is an embryonic plant that is enclosed in a protective outer covering, containing a food…

Q: Why do scientists think that new genes arise by duplication of an original gene and divergence by…

A: Genes are the fundamental building block and essential component of heredity. Genes grow and evolve…

Q: Are there any differences between monocot and dicot seeds? Tabulate these differences (if any).

A: Angiosperms or flowering plants are broadly classified into two main groups - monocotyledons and…

Q: If you have a friend or family member working at a high risk of a silicosis exposure-related…

A: Workers who breathe in crystalline silica experience fibrotic nodules and damage around the…

Q: Can you think of anything that would prevent meiosis from occurring in an organism whose genome is…

A: Cell division is a biological process that involves production of two identical daughter cells from…

Q: A mutation was introduced to the original DNA and now you have following DNA sequence (the mutation…

A: A mutation is the change in the genetic material of an organism. A point mutation is the mutation…

Q: 69. The greatest number of estrogen-secreting cells within a normal corpus luteum derives from which…

A: The corpus luteum is a fundamental yet temporary organ that assumes a important part in fertility…

Q: DIHYBRID CROSS Heterozygous Yellow and heterozygous round seed crossed with homozygous yellow and…

A: Alleles for both parents - A. Y for yellow seed and y for green seed B. R for round seed and r for…

Q: Summary: In primary active transport, what provides the energy needed to move solutes against a…

A: Simple passive diffusion and facilitated diffusion are fundamental forms of membrane transport.…

Q: Identify this organism by genius name

A: Microbes are extremely minute living entities which are everywhere and are invisible to the unaided…

Q: Draw the chart, demonstrating the mechanisms action of epinephrine on target cells (the typical…

A: Epinephrine It refers to a hormone that plays an important role in the fight-or-flight response of…

Q: The correct description of altruism by kin selection is that O An individual helps because all of…

A: The coefficient of relatedness (r) is a measure of how related two individuals are. It is usually…

Q: Atrial fibrillation (AF) is a rapid and unorganized beating of the upper chambers of the heart.  It…

A: If the hazard ratio is 0.60, the likelihood of surviving one day with this diagnosis is 99.4%, the…

Q: What are the functional significance of differences in shell morphology among gastropods and…

A: The shell is basically an exoskeleton.It can protect from predators,mechanical damage and…

Q: hat happens during the active segmentation stage of zygote?

A: The two basic events of sexual reproduction are gamete formation and the fusion of male and female…

Q: A recent metagenomic study analyzed the microorganisms present on surfaces within the entire subway…

A: Introduction: Microorganisms are tiny, microscopic organisms that are found both within and outside…

Q: 12445 RD-Hom 4(167-277) A(194-277) A(97-138) A(97-167) 6 A(97-194) N595A 7890 A(619-723) HD 10…

A: A regulatory protein regulates the expression of a gene by binding with that gene through its DNA…

Q: 1. Write the differences between the autonomic nervous system and the somatic one. Somatic nervous…

A: Introduction The somatic nervous system includes cranial nerves except optic nerve. The autonomic…

Q: What is the map distance between the two rapid lysis mutations rª and rª given the data below? re- X…

A: Identifying the recombinant frequency in the cross can help in identifying the map distance between…

Q: State the function of the digestive system in animals Describe how plants obtain their nutrients for…

A: In order to maintain cellular processes, animals must break down macromolecules into simple…

Q: Say, I have two offspring of my own and also three nephews in Michigan who I have never interacted…

A: The ability of a single organism to pass on its genes to the next generation while taking into…

Q: The plant picture below, and most likely have what type of root system

A: The part of the plant axis that is descending towards downward direction is referred as the root…

Q: 1. Describe how gas exchange occurs at the gills of the fish.

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: How many different DNA strands composed of 100 nucleotides could possibly exist?

A: The units known as nucleotides are the building blocks that make up the linear DNA (deoxyribonucleic…

Q: Plz answer the question in 10 mints plzzzzz it's very urgent plzzzzz

A: Bipolar disorder is a disorder in which there is mood swings from depressive low to high maniacs and…

Q: What mutations would have the greatest effect on peptide sequence? Which would have the least…

A: Introduction A mutation is a rapid, heritable alteration in an individual's phenotype. A mutation is…

Q: Match the letter on the tree of life below to the description. Animals Fungi Plants Protists Archaea…

A: Inroduction In five kingdom classification there are five kingdoms, monera, protists, fungi, plant…

Q: aims and objectives of citric acid biomanufacturing

A: Introduction The Uses of Citric Acid are:- It functions as an antioxidant. It is a cleaning agent…

Q: C. SLIDE: Ranunculus mature root xs (Text p. 566) 1. Draw and label: epidermis, cortex, vascular…

A: The Ranunculus belongs to the family Ranunculaceae and is a member of flowering plants. The mature…

Q: Define hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…

A: Hormones function as messengers in the body. They are secreted by endocrine glands. Hormones help in…

Q: A group of birds colonize an island.  Over time, they become different from the mainland source…

A: A group of birds colonize an island.  Over time, they become different from the mainland source…

Q: 5 Examples of adult cytogenetics test and applications

A: Cytogenetics is the branch of genetics deals with the study of chromosome abnormalities like…

Q: QUESTION 2 In a Phenome-wide Association Study (PheWAS) where we are trying to link genotypes and…

A: Phenome-wide association studies (PheWAS) searches for phenotypes that is associated with specific…

Q: Which is mandatory for speciation to occur?    • reproductive isolation • migration •divergence in…

A: Definition of speciation: Speciation is basically evolution of multiple species just from one…

Q: Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example…

A: Introduction  When one original DNA molecule is split into two identical replicas, this biological…

Q: Bacterial genomes such as that of E. coli typically have only a single origin of replication, from…

A: Introduction: E. coli is a member of the group of bacteria known as "coliforms." Coliform bacteria…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.