G-C A-T OT-A N-C C-G H N=C N-HO Which DNA base pair is represented in this figure? N-HIN HIN I H C-H
Q: 1.What are nucleic acids? What are their functions? 2.Illustrate and compare the primary and…
A: Nucleic acids are one of the biomolecules that are important for the carrying of genetic information…
Q: why the human dna is considered as a fibonacci sequence?
A: A Fibonacci Sequence is where each number is the sum of two preceding numbers, like…
Q: Experiment used to confirm the type of inhibition exerted by AZT on the HIV reverse transcriptase…
A: AZT is a substrate analog of thymidine. Thymidine is a substrate of the reverse transcriptase used…
Q: When does proteolysis begin in long-term starvation?
A: Malnutrition is a condition in which the body receives insufficient calories, protein, vitamins, or…
Q: The functional group involved in glycosidic linkages is: ester carboxylic acid O amide ether
A: Glycosidic linkage is the bond that connects the monosacharide sugar units to form disaccharides or…
Q: 2. Characterize the physical chemical properties of protein solution. What is the viscosity of the…
A: Proteins are made up of amino acids and they form peptide bonds linking the amino acids. Thus…
Q: 1. A 2M NaCl solution and a 2 M glucose solution are separated by a semi-permeable membrane,…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: 9.3 Identify which of the following are a-amino acids. CH3 | H₂N-C-COOH CH, a. b. H H₂N-C-CH₂-COOH…
A: The proteins are constituted of 20 naturally occurring amino acids. The amino acids are all alpha…
Q: You have isolated a new endoglucanase enzyme. Through various enzymes assays, you are trying to…
A: Enzymes are biomolecules that catalyse biochemical reactions. They are made up of proteins. They…
Q: The 3° structure of a protein refers to the protein's overall, 3-dimensional shape in space. This…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Which of the following is an example of a primary active transport? a.CPT-I b.Na+/K+ pump…
A: Animal cells are usually surrounded by a cell membrane which acts as a structure that regulates the…
Q: Which amino acid has a guanidino group? Histidine Arginine Tryptophan Aspartic acid Which amino acid…
A: Introduction: Amino acids are organic molecules that contain a carboxyl and an amino group with a…
Q: 3. Using mathmatical calculations, show why 0.9% NaCl solutions and 5% dextrose (glucose) solutions…
A: Hypotonic Solution: A fluid that differs from regular blood and cells in that it contains fewer…
Q: Find an example of an enzyme. Answer the following questions about the enzyme that you chose. a)…
A: Enzymes are proteins produced by living organisms to catalyze specific metabolic and biochemical…
Q: What are the two stages in Photosynthesis called and where in the chloroplast does each stage take…
A: Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to make oxygen…
Q: но- В с OH OH HO-P-0 OH Ora HO-P-O- OH OH OH OH OH OH NH NH OH OH OH NM₂ NH "NH₂
A: Nitrogen bases are the aromatic complexes that are found in nucleic acids. These compounds play a…
Q: What are the three names for the metabolic cycle that occurs in the matrix of the mitochondria?…
A: In the eukaryotic cells, the citric acid cycle occurs in the matrix of the mitochondria. The proton…
Q: What is the precursor of Cholesterol? a.Acetyl-CoA b.Glycerol c.Isoprene d.Fatty acid
A: Cholesterol is produced by the liver as well as by the majority of cells in the body. Lipoproteins,…
Q: O HO NH₂ ZI Z-/
A: Aminoacids are the building blocks of proteins that consists of Amino group and carboxyl group as…
Q: Which of the following is/are NOT (an) essential fatty acids? A. arachidonic acid B. linoleic acid…
A: Essential fatty acids can be defined as those fatty acids which body cannot synthesis but are…
Q: After transcription, the molecule that is formed is a.complementary to part of one strand of DNA.…
A: Transcription is the process that is catalyzed by the RNA Polymerase enzyme. In this process a…
Q: 19.28 Identify the amino acids contained in the tripeptide below: Ο H Η Ο Η || Ï ||…
A: Proteins are made up of amino acids and each amino acid has different functional group (R- group).…
Q: b. What amino acids are destroyed during acid and basic hydrolysis? Type of Hydrolysis Acid Basic…
A: Both acid and basic hydrolysis are done to quantify amino acids present in proteins and peptides.…
Q: What would the quality of the line-fit (R2 value) be if you do not exclude experimental outliers?…
A: Biuret assay is based on the generation of a purple colour when protein reacts with cupric ion in…
Q: Which of the following accessory pigments is the first e- acceptor in the electron transport chain?…
A: The light reaction of photosynthesis involves the transport of electrons through various electron…
Q: 7. What does Gram staining reveal owing to its use in clinical diagnosis? Explain briefly.
A: The process of determining a condition, disease, or damage based on its signs and symptoms. A…
Q: Which of the following substances is the precursor of Cholesterol ? I.bile salts II. testosterone…
A: Cholesterol is a type of lipid that acts as the component of plasma membrane and maintains the…
Q: You have a semi permeable membrane with a membrane potential of -90mV. You also have two ions that…
A: Recall that the Nernst equation for calculating reversal potential is: Eion = RT/Zf log [Co]/[Ci]…
Q: Within the image, identify base-pairing nucleotides by dragging the nucleotide name to its target. A…
A: Nucleic acid includes DNA & RNA. Nucleic acids are composed of nucleotides (sugar + nitrogenous…
Q: A fully folded, functional single polypeptide is in ____________________ structure.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following statements about the ß-oxidation cycle is/are TRUE? A. The fatty acyl…
A: In the Beta-oxidation of fatty acid cycle, there are four steps involved : 1. First Oxidation -…
Q: Which of the following statements correctly describes promoters in E. coli a.A promoter may be…
A: A promoter is a short region of DNA upstream of the start site of a gene at which the RNA Polymerase…
Q: Which proteins help other polypeptides to fold into the right shape?
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: Structurally, lipids are a very diverse group but they are all placed in one group because of what?…
A: Lipids are an important biomolecules and plays ab important in the metabolic activities of our…
Q: The phenol concentration of wastewater was determined from three (3) parallel determinations, giving…
A: As per the given experimental data; Mean of phenol concentration of wastewater: 0.513 μg L-1…
Q: What amino acids are most likely to be found in the core of a water-soluble globular protein? a)…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: 50 words essay on how important to have an adequate knowledge of biochemistry in understanding…
A: The branch of science that deals with the chemical substances and the processes involving them, that…
Q: You are given a protein solution with a concentration of 0.15 mg/ml. Suppose that we want to prepare…
A: An analyte must be present in detectable concentrations. Depending on the requirements of the…
Q: How do cells maintain the fluidity of their membranes? If a bacterium was growing at 20°C, how would…
A: The biological membranes of cell are selectively permeable. Fatty acids form an integral part of the…
Q: What is the significance of acetyl-CoA to lipid metabolism?
A: The synthesis and breakdown of lipids in cells is known as lipid metabolism. It involves the storing…
Q: Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a…
A: DNA polymerase is an important enzyme of dna replication and can add nucleotide triphosphates to 3’…
Q: Phospholipase responsible for the tissue damage after spider bite? a.A1 b.A2 c.D d.C
A: Phospholipase (PLA) is a lipolytic enzymes which cleaves the phospholipid substrates at specific…
Q: 2. Complete Table 1 below by supplying the characteristics of each objective. Table 1. Numerical…
A: A microscope is an instrument used to make very small objects or things visible to the naked eye. It…
Q: Which of the following families:amino acid classifications is/are correct? a.aromatic:Met…
A: Amino acids are biomolecules that have an amino group a carboxyl group and a side group attached to…
Q: A C2 G This a photograph of an actual polyacrylamide gel that has been run with samples of protein.…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Draw three amino acids making a polypeptide – be sure to name each amino acid and the peptide bonds…
A: Amino acids are the basic subunits of polypeptide chain. Its alpha carbon contains amine group,…
Q: Why does with a high A-T content have a lower melting temperature, Tm, than DNA with a high G-C…
A: Nucleoside: a nitrogenous base + a pentose sugar Nitrogenous base: Adenine, Thymine, Cytosine,…
Q: Although high cholesterol level is associated with cardiovascular disease, cholesterol plays an…
A: Cholesterol is an essential fat that is present in our body and is important for the synthesis of…
Q: Can you solve and show your solutions how to get the buffer regions/effective pH range of Cys?
A: Buffer zone/region in a range where the pH of the solution remains constant despite the dilution or…
Q: Which of the following statements does NOT apply to Mg2+ It is important in the mammalian aldolase…
A: Mammalian aldolase (Class I aldolase) catalyzes the aldol condensation reaction where fructose…
please answer these 2
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 : T-A-G-C-C-C-T-G-G-T-C-T-T-TStrand 4 : A-C-C-G-G-C-T-C-G-A-C-T-T-C How to Fill Out This Chart: Write the number of the strand you are using in the first column, and then write out thenucleotides from the strand of DNA you picked in the boxes moving down the chart. Now, line up the first three nucleotides of the DNA strand with the first three spaces for mRNA.Write the matching nucleotide on the mRNA strand. (Remember to use Uracil).**Leave the short ones blank, that’s just to show you codons. Once you have your mRNA completed, fill out the mRNA column. You have now transcribed the strand of DNA to mRNA, which can now leave the nucleus. Remember acodon is a sequence of three nucleotides. Draw a box around all the codons (or three in a row). These areimportant for looking at how that information is translated into amino acids or Translation. Think of it asthe language of nucleotides is being…EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .SspI --- 5' AAT - ATT 3'5' GGATAATATT GTTAACAATCTCTACGGGTTAACACCCTTGGAATATTTTAA 3' 3' CCTATTATAACAATTGTTAGAGATGCCCAATTGTGGGAACCTTATAAAATT 5' Number of pieces of DNA _______
- Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’X: protein, DNA, chromosome Y: protein, DNA, chromosome Z: protein, DNA, chromosomeI-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R The amino acid sequence above forms an alpha helix. Place the amino acids on the wheel given below. L1 represents Leu.
- 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:HpaI --- 5' GTT - AAC 3'5' GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3' 3' CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5' Number of pieces of DNA____which letter dipicts leading strand A. J B. B C. K D. L
