Answered: Create the complimentary strand for the…

Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: A. 1. Create the complementary strand for the DNA strand below. Make sure to label the parts and…

Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino…

A: Transcription is the process in which m RNA is synthesized and the translation is the process in…

Q: Draw a stretch of DNA that would code for the amino acid "lysine". Be sure you draw all the…

A: The given structure is shown below.

Q: 2. 3. Original - (template) DNA Adenine Thymine Cytosine Guanine 7._ Original (template) DNA strand

A: DNA replication is the process which produces daughter dsDNA from the parental dsDNA. It takes place…

Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?

A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…

Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…

A: For making complementary strand ,we need to follow base pairing rule . Base pairing rule :…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: The orginal strand is 5' G-A-C-C-A-T 3' Question: What is the new replicated DNA strand? The…

A: In atomic science, DNA replication is the natural procedure of creating two indistinguishable copies…

Q: Draw a short segment of a single polynucleotide strand, including at least three nucleotides.…

A: A nucleotide has three components namely,(a) A nitrogenous base.(b) A pentose sugar (ribose in case…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…

A: DNA replication :- It is the formation of a new DNA from a pre existing DNA. The DNA so formed is…

Q: Give the COMPLIMENTARY DNA strand. 3'TAC TAC TTT AMA TCA CTC TCC GCT GGT GTG AGT TGC CCT ACT 5

A: Deoxyribonucleic acid or DNA is a biomolecule composed of two polynucleotide chains that coil around…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Refers to the two strands of DNA double helix. Please choose one answer only. A. Nicks B. Templates…

A: Introduction: As it relates to genomics, the phrase "double helix" is used to define the actual…

Q: Give the complementary strand of DNA to the following strand, and then the RNA strand based off the…

A: DNA is made of two strands linked together by hydrogen bonds. Complementary base pairing occurs…

Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other…

Q: Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and…

A: DNA It is Deoxyribonucleic acid. It is defined as a molecule that constitutes two polynucleotide…

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…

A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: Write the sequence of the DNA strand complementary to the following strand:…

A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…

Q: Which enzyme can recognize an altered base in the DNA? Group of answer choices DNA Polymerase AP…

A: There are several DNA repair mechanisms are present that are- direct repair system, excision repair…

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…

A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…

Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…

A: They enhance the rate of a reaction without being consumed or modified during the reaction.…

Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…

A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…

Q: The two DNA chains are held together by complementary base pairing between A and T bases and between…

A: DNA are made of Nucleotides . A phosphate group, a sugar group, and a nitrogen base are all found in…

Q: One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on…

A: Deoxyribonucleic acid (DNA) is defined as an organic chemical molecule that will contain all the…

Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB

Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…

A: DNA Is a Polynucleotide. DNA is composed of nucleotides strung together to make a long chain called…

Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…

Q: true or false: Bases pair up quickly on the leading strand, however, the bases have to be filled in…

A: The semiconservative DNA replication scheme proposed by Watson and Crick states that when the double…

Q: Write the DNA strand that is complementary to the strand shown below. Be sure to mark the ends of…

A: DNA is a polymer of nucleotides and a double-stranded molecule.

Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Which is the odd one out ? explain how the rest are connected. primers dNTPs DNA polymerase…

A: The polymerase chain reaction (PCR) is a widely used method for rapidly making millions to billions…

Q: In the diagram below, identify the DNA by clicking on the correct highlighted portion. TACGGGCTA

A: J.D Watson and F.H.C.Crick (1935) proposed a double helix model of DNA molecule, this is the widely…

Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…

A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…

Q: Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGG

A: The genetic code is a series of three-letter nucleotide combinations called codons, each…

Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B=3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…

A: A hairpin loop has a stem that contains complementary bases and a circular structure that does not…

Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…

A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…

Q: Given the DNA molecule, draw the complementary piece under: TAGCTTAGCG

A: In DNA, 4 bases are there which involves Adenine, Cytosine, Thymine and Guanine. These bases are…

Q: S ..GACTAAGGCTTAGS CTGATieCGAATGS .CTGATTCCG AA TG 5 NEW STRANDS (Fill in the correct bases and…

A: DNA is the genetic material of a cell that carries hereditary information required for the survival…

Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…

A: Introduction: Adenine binds to thymine and guanine binds to cytosine as they are complementary base…

Q: If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…

A: Question -If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…

Question

Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand.

5’-GGCAACGGTCCAGTCCAAGTTACG-3’

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required
Translate the .sequence of bases in the previous question, starting at the second base.
Describe the structure and complementary base pairing of DNA.
What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'- A A C G G T C C A G T C C A A G T T A C G-3'
Complete the complement strand of DNA by providing the correct base pairs. Template Strand: CGATACAAA
View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-k
If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of complementary strand in 5'→3' direction
The _____________ strand is made continously.
Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCAT
Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'