Gene: Yfh1 The name of the protein and its function in yeast. What effect the protein has on the function of the yeast cell. İdentification of an orthologue present in humans A description of how mutation of the orthologous protein in humans has on the human cell and any implications for disease in humans.

Gene: Yfh1 The name of the protein and its function in yeast. What effect the protein has on the function of the yeast cell. İdentification of an orthologue present in humans A description of how mutation of the orthologous protein in humans has on the human cell and any implications for disease in humans.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 1SA: Gene expression does not vary by ________. a. cell type c. stage of development b. extracellular...

See similar textbooks

Similar questions

A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
Researchers have successfully used gene therapy toameliorate some human genetic diseases by adding anormal gene copy to cells whose genomes originallyhad only nonfunctional mutant copies of that gene.For example, a form of blindness due to the lack of asingle protein called RPE65 has been reversed byintroduction of a normal RPE65 gene to cells of theretina of adults.a. The success of this gene therapy approach providesus with clues about the role of the RPE65 proteinin the retina. Do you think that RPE65 is neededfor the proper development of the human eye?b. Can you see a potential difficulty in applying this genetherapy approach for diseases like microcephaly?
Retinoblastoma is a rare cancer in which tumors developin the retina of the eye. The tumors arise because of theloss of the Rb gene, which codes for a tumor suppressor.Hereditary retinoblastoma usually appears in children whohave inherited only one functional copy of Rb. Explain whythe nonhereditary form of retinoblastoma usually occurs laterin life.
Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR. Studies of this gene have found that the Gene includes 250,000bp in the DNA. Scientists found that the mRNA had 6,500 nucleotides, and the final protein had 1480 amino acids. How much of the mRNA is untranslated? How much of the RNA that is produced does not leave the nucleus? One of the mutations that results in a disease phenotype can be easily identified because the mutation results in a much longer mRNA then normal. Where would you look for this mutation? What might this mutation have affected?
ABOUT Phenylketonuria Explain Potential technical issues and limitations of PCR technology are mentioned Correct information about tissue that can be used to test for a genetic disease and justification of tissue selection Detailed information about the position (exact base pair number) of the new mutation relative to the sequence of the PAH gene. Numbering is based on the start of transcription of the PAH gene. PLEASE ANSWER ALLLL PLEASEE
Many viruses contain their own enzymes for replicating theirgenetic material, whereas others use the host cell’s enzymes.Would DNA viruses or RNA viruses be more likely to producetheir own enzyme(s) for this purpose, and why?
Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…
CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype
: The effects of DNA mutations within the p53 gene on the structure and function of the protein encoded by the gene. The essay should focus on the following discussion points: The normal functions of the p53 gene. Known mutations of the gene. The impact of mutations on the structure of the protein encoded by the gene. The impact of mutations on the function of the protein. Current therapeutic interventions that aim to address the impact of mutations on gene function
. While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.
Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA
The family of a sixth-grade boy in Palo Alto, California, wasinformed by school administrators that he would have to transferout of his middle school because they believed his mutation ofthe CFTR gene, which does not produce any symptoms associatedwith cystic fibrosis, posed a risk to other students at the schoolwho have cystic fibrosis. After missing 11 days of school, a settlementwas reached to have the boy return to school. What ethicalproblems might you associate with this example?