From the article entitled "Is there a role for carbohydrates restriction in the treatment and prevention of cancer?" answer the question isdelf in not more than 5 sentences
Q: Name a disease treated with a protein produced by genetically engineered microorganisms.
A: Genetically modified organisms (GMO) are those organisms whose genetic sequences are changed by…
Q: DNA database growth and use in the USA
A: DNA database is a repository of the DNA profile which is used to identifying criminals, DNA…
Q: If 20% of the DNA in a guinea pig cell contains adenine nucleotides what percentage is cytokines…
A: A DNA double helix is formed by complementary pairing of bases, Purine bases bonding with…
Q: Involves comparing the genomes Genomics Metabolomics Proteomics all of these
A: ▪︎Genomics is the study of full genetic complement of the organism or it is the study of all the…
Q: What could be the consequences of loss of function the enzymes in the below: a. Helicase b.…
A: The given enzymes take part in transcription. Transcription is the process in which RNA molecules…
Q: Plasmids are found
A: Answer 2 is Option A is correct. Plasmids are naturally occurring circular, extrachromosomal,…
Q: Virology :Which genome type results in the fastest route to +mRNA
A: Viruses are obligatory intracellular pathogens. The virus particles are acellular and contain a…
Q: CRISPR in summary
A: CRISPR stands for clustered regularly interspaced short palindromic sequence. It's the gene editing…
Q: d on the given transgenic organism, give a brief explanation on the alterations of the organism
A: A plant, animal, or microorganism whose genetic material changed using technology that generally…
Q: Why may some bacteria use extracellular enzymes to form blood clots? View Available Hint(s) for Part…
A: Option B. Blood clot can hide bacteria from the immune system
Q: The ____ plasmid contains genes for synthesizing connections between donor and recipient cells.
A: The plasmid is defined as a small, circular, extra-chromosomal, double-stranded DNA molecule present…
Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…
A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…
Q: 1.2 A colony of bacterial cells is exposed to UV-light. 1.2.1 What mutation will probably result…
A: MUTATION FROM UV LIGHT EXPOSURE Ultraviolet light induces specific mutations in the cellular and…
Q: Write the name of disease occur due to Nonhomologous End Joining Repair.
A: When their is defective Function of DNA break repair , then it is known as DNA repair defect which…
Q: PLs put these into punnet squares
A: The Punnett square is a square diagram used to predict genotypes in a cross or breeding experiment.
Q: restriction enzyme“
A: Restriction Enzyme Restriction enzymes are enzymes that helps in the cleavage of DNA into different…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: Use at least 25 of the 40 terms below to create a concept map, linking the term together with…
A: A concept map is a map that connects the given term. This concept related DNA, to proteins that are…
Q: In a laboratory experiment, a student grew a colony of bacteria from a fecal sample. She suspected…
A: E. coli is Eicherichia coli and it is a facultative, gram negative, anaerobic bacteria which is…
Q: what is means cross-contamination in animal cell culture?
A: Biological cells can be grown and developed in laboratory conditions by cell culture techniques. It…
Q: What are the kinds of DNA damage due to radiation?
A: DNA damage An alternation in the chemical structure of DNA, such as a break in the strand of DNA, a…
Q: Cytochrome C Study A scientist wants to study the cytochrome c gene of a fruit fly. The DNA for the…
A: Restriction enzyme cleaves DNA at specific sites along the molecule The DNA After specific…
Q: How bacteria cells differ from human cells. Please give an example. Thank you!
A: Cells - Cell is the basic structural and functional unit of life. Cell is the basic unit of life in…
Q: PART B Re-watch the video and explain why the following steps are necessary: Why use tweezers to put…
A: Please note as per the site regulations, external links are not watched. Hence, part A cannot be…
Q: Sample of designer GMO and answer the ff questions 1. What is the name of your “designer GMO”? 2.…
A: GMO It means Genetically Modified Organism. These organisms have their genetic material manipulated…
Q: s it possible that garlic has properties to cure cancer? Explain in 3 paragraphs.
A: Garlic and its taxonomical position --- Facts about Garlic --Garlic name is derived from garleac…
Q: Write one factor common in both terms and one factor which differentiates both terms. a. Mammalian…
A: Culturing the cells refers to growing them under laboratory conditions.
Q: What is peptidoglycan and why is it important?
A: Bacteria are microscopic single-celled prokaryotes that thrive in diverse environmental conditions.…
Q: Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: |…
A: Q. Frameshift mutation: A frameshift mutation is a genetic mutation that occurs when a deletion or…
Q: Write down the name of major product formed due to absorption of photon in DNA and its consequence.
A: A molecular lesion can be described as structural damage to the genetic material such as DNA or RNA,…
Q: For each function, please name the enzyme or ribozyme that performs the function. 1. Transcribes…
A: DNA are transcribed into RNA and then the RNA is translated into function proteins in cells.…
Q: First chemicals used to induce cancer? A. Bleach B. Battery acid C. Antifreeze D. Coal tar…
A: Bleach does not cause cancer, because of that the first option is wrong
Q: Write an account of the use and potential of nucleic acids as therapeutics. Provide in your answer…
A: Nucleic acids are biological polymers made of nucleotide monomers. Each nucleotide comprises a…
Q: Telomerase is a very important enzyme for the control of both cancer and aging. In 5 sentences,…
A: The ends of the linear chromosome is known as telomere,it is rich in the tandem repeats of…
Q: What are two ways that the human insulin gene sequence was modified by geneticists so that bacterial…
A: Insulin and glucagon are hormones that assist control glucose levels in the body. To maintain…
Q: Give information about the microchip that could control drugs invented by Robert Langer and Michael…
A: Designed by Microchips Biotech co-founders Michael Cima, the David H. Koch Professor of Engineering,…
Q: What general type of growth medium would you use to: (a) grow one type of bacteria but inhibit the…
A: Answer a) Selected media prefer the growth of one microbe but block the others. It is made of…
Q: (AKS 8a2, DOK 1) What are the benefits of using the biotechnology technique shown below? A. В. С. D.
A: Ans: The given image is of resolved DNA bands on an agarose gels. This technique has been…
Q: Mitichondrial DNA is a kind of DNA that is found in the cells of mitochondri Provide a succinct…
A: Yes, mitochondrial DNA is a kind of DNA found in the mitochondria. It is different from the DNA…
Q: escribe how the plasmid is cut open by genetic engineers? 2. How is the insulin gene removed from…
A: Since you have ask multiple question, we will solve the first question for you. If you want any…
Q: Explain why the following statement is false: Sexual reproduction is the only mechanism for genetic…
A: Explain why the following statement is false: Sexual reproduction is the only mechanism for genetic…
Q: A scientist wants to study the cytochrome c gene of a fruit fly. The DNA for the gene is extracted…
A: Restriction enzymes are molecular scissors that are used in Recombinatinant DNA technology. It is…
Q: Use the following diagram to answers the questions. A. Is this cell Gram + or Gram -? Provide 2…
A: Bacteria are a broad collection of tiny, unicellular creatures that have been classed as prokaryotic…
Q: Use the diagram to answer the following three questions. 5' TTAGGGITAGGGTTAG 3' || CAAUCCCAAUC…
A: (a) Write next six bases that would be added by telomerase using the format 5'NNNNNN3'…
Q: a)List and describe the purpose of each component of the restriction enzyme digest.
A: Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: Explain the term nucleases.
A: The biological catalyst associated with the function of accelerating the rate of the chemical…
Q: Hello, Can you please explain what is Schindler CleanCover and how it is used to kill the bacteria.
A: Antibacterial is anything that is used to stop the growth of bacteria by killing them or by making…
Q: A proteolytic enzyme has the following action: 1. It cleaves complex sugars into simple sugars. 2.…
A: Proteolytic enzymes are the enzymes that breaks proteins into smaller peptide fractions and amino…
Q: A branch of the biological sciences that is interested in studying whole metabolites and pathways in…
A: Biological science comprises all the division of science that deals with the vital process involved…
From the article entitled "Is there a role for carbohydrates restriction in the treatment and prevention of cancer?" answer the question isdelf in not more than 5 sentences.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Give an example for any biopharmaceutical produced by Recombinant DNA Technology (except insulin). Answer option a,c,d a. What is the name of the drug/trademark?b. Write its mode of action.c. List the experimental steps under the laboratory conditionsd. List the production steps in the factoryExplain the process of Transcription and Translation. List three antibiotics and explain how these antibiotics inhibit the protein synthesis.A patient presents with the Sickle Cell Trait. How did this disease develop in the DNA and howdoes this translate to how the protein is produced in the cell?
- Write a detailed note on Boron and Its application in Cancer treatment.Define the following terms: a. PABP b. lipophilic modification c. methylation d. Kozak sequence e. carboxylationNitrous acid replaces amino groups with keto groups, a processcalleda. alkylation.b. deamination.c. depurination.d. crosslinking.
- Give typing answer with explanation and conclusion to all parts The 5-FU metabolite F-dUTP is incorporated into? a) Neither b) RNA c) DNA The 5-FU metabolite F-dUMP is incorporated into? a) DNA b) Neither c) RNARefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?A multinational company outside india tried to sell new varieties of turmeric without proper patent rights.what is such an act referred to?
- Define the following terms:a. enzyme inductionb. covalent modificationc. nucleotidylationd. allosteric sitee. compartmentation. Dideoxynucleotides are often used to perform ____________________Would it be possible to calculate the cost of protein synthesis, including the cost of making mRNA and DNA?