It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).

Q: When does DNA replication take place?     during the S phase of the cell cycle     when the cell…

A: Question - When does DNA replication take place?   A) during the S phase of the cell cycle…

Q: Each metaphase chromatid is about 700 nm in diameter. How many times wider is that than a DNA double…

A: Metaphase: The chromosomes are aligned at the equator. Each chromosome has one sister chromatids are…

Q: Bio-123 Mitosis Post Lab 7. Complete in the following diagrams that show mitosis ina cell (2n 4).…

A: Mitosis is the process of equal distribution of chromosomes among daughter cells during cellular…

Q: the information stored in gene transferred to a similar molecule called RNA in the nucleus.…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: Chromatin of eukaryotes is organized into repeating interactions with protein octamers called…

A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…

Q: Across 18.) structure consisting mainly of microtubūles that provides the framework for chromosome…

A: Cell division is an important and essential process that is needed for repair as well as growth and…

Q: Which of the following solves the problem of shortening of chromosomes in each cell cycle?a) DNA…

A: The DNA replication mechanism is a semiconservative replication in which the parent DNA acts as the…

Q: Chromatin is OA complex of cohesin proteins O Where sister chromatids are most closely attached A…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: me organismyou are working with has the following chromosomes. Place the chromosomes of this…

A: The mitosis is the cell division process by which a diploid (2n) mother cell divide and produce two…

Q: erase, b)RNA polymerase, c)DNA polymerase, d)ribosome] finishes copying the [ Select ] [a)rRNA,…

A: The process of transcription ends when RNA polymerase finishes copying the mRNA from the DNA and the…

Q: Which is more stable in a cell—DNA or RNA?

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: Just answer, no need to explain.  During prophase of mitosis Select one: A.the spindle breaks…

A: Disclaimer: As per Bartleby guidelines, we will answer only the first question. Kindly repost the…

Q: When in the cell cycle does the cell repair the DNA damage shown? UV light CH2 P. CH2 T. Kink P. CH2…

A: DNA proofreading and the repair system usually detect and fixes the DNA damage caused by mutations…

Q: lividing cell? O the centrosomes are constantly digesting spindle fibers making it shorter pulling…

A: Mitosis is the type of cell division in which one cell is divided into two daughter cells. it…

Q: Small extrachromosomal rings of DNA, often contain genes that give bacterial cells genetic…

A: Small extrachromosomal rings of DNA, often contain genes that give bacterial cells genetic advantage…

Q: The basic building blocks of chromatin structure- DNA .A O Nucleosome.B O Selenoid .C O Protein .D O

A: DNA(deoxyribonucleic acid) is a molecule comprised of two polypeptide chains that coil around each…

Q: METAPHASE OF ONION ROOT CELL (PLANT CELL)   describe the appearance of DNA, spindle fibers and…

A: To divide, a cell must accomplish many things: expand, reproduce its genetic material (DNA), and…

Q: Disdis -how do RB and p53 negatively regulate the cell cycle in G1? describe the events that occur…

A: A series of events which takes place in a cell due to which it divides and forms two daughter cells…

Q: Instead of randomly placed DNA within the nucleus of a eukaryotic cell, it seems that regions of DNA…

A: Introduction: In eukaryotic organisms, the genetic code, DNA, is found to be located inside the…

Q: For a chromosome to duplicated in a cell, there must me a region on the DNA strand called the where…

A: Replication It is process in which the existing DNA gives rise to a new DNA strand. Various…

Q: Explain how cell division is different in prokaryotic and eukaryotic cells. Also, compare the DNA of…

A: Prokaryotic cells are simple cells with many cell organelles absent in it such as the nucleus,…

Q: For each of the following pairs of chromatin types,which is the most condensed?a. 100 Å fiber or 300…

A: There are four levels of condensation: Nucleosome – DNA is tightly complexed with histones, wrapping…

Q: and Words for each. wnte Rewrite the following definition S down the Keywords DNA Code of life DNA…

A: DNA is often called as the 'code of life' as it is actually a code that contains information to…

Q: When chromatin is condensed, transcription cannot happen. Why not? RNA cannot access the promoter…

A: The epigenetic regulation involves methylation and acetylation. By this process the gene expression…

Q: 1 2 3 4 Here is a replication fork during S phase of the cell cycle. DNA strands are labeled 1-4.…

A: The DNA is a double stranded molecule which unwinds during replication. During replication one…

Q: During Mitosis, the spindle apparatus becomes connected to the:

A: The correct answer is Centromere .

Q: 1 2 3 4 Here is a replication fork during S phase of the cell cycle. DNA strands are labeled 1-4.…

A: Semiconservative DNA replication The replication of DNA takes place in S phase of the cell cycle…

Q: Sameness and Variety (Mitosis and Meiosis) 161 Example Expressed using apples, DNA replication looks…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: Across framework for chromosome movement during cell division 19.) the stage of cell division in…

A: DNA is genetic material present inside the nucleus of the cell which carries genetic information .…

Q: DNA Replication = the location DNA replication takes place is in the DNA in the Nucleus DNA…

A: Process Where 01. DNA Replication DNA replication occurs in the nucleoplasm of the Nucleus at…

Q: When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG…

A: The cell cycle is a sequence of events before cell division occurs, it prepares cells for division.…

Q: Cytokinesis in Plant Cells • A plant cell has a rigid cell wall covering its cell membrane ( plasma…

A: When a parent cell divides into two or more daughter cells, this is referred to as cell division.…

Q: cell's genome O contains all of a cell's DNA. O is defined as all the genes being used to make…

A: Microbes are microscopic organisms that cannot be seen with unaided eyes. They are present…

Q: DNA plus associated proteins equal?  a. chromatin b. chromosome c. chromatid d. nucleosome

A: Introduction :- Proteins are big, complex molecules that play a number of important tasks in the…

Q: When replication happens, how much of cell’s DNA will be replicated? Select one: a. All of it – all…

A: DNA replication is the biological process in which two identical DNA are produced from one original…

Q: During mitosis the chromosomes line up in the middle of the cell are copied all of the above are…

A: Question 11 During mitosis a cell divides to form two daughter cells and the daughter cells have…

Q: Decondensed chromatin, but not condensed chromatin O can be remodeled. is associated with…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Which of the following is an element of a eukaryotic chromosome that plays an essential role in the…

A: DNA replication is a process of duplication of a cell. A new DNA strand is synthesising…

Q: Two diplold cells DNA replication Mitosis Figure 1 Gernaing Nles Eye Huds Bods Alventious Root bols…

A: Cells are microscopic and they vary in size. The animals made up of single cells are unicellular…

Q: INTERPHASE OF PLANT CELL

A: INTERPHASE  OF PLANT CELL: The plant cells are found to be : Large in size and has fixed regular…

Q: h eukaryotes, genetic material is packaged tightly in the nucleus. Which one of the ollowing most…

A: 1) In eukaryotes, the DNA molecule of the chromosomes are tightly packed to fit itself inside the…

Q: DNA replication occurs between metaphase and anaphase, doubling the number of chromosomes. Between…

A: Cell division is defined as the process by which a cell, referred to as the parent cell, will divide…

Q: 30nm filament O is the next level of chromatin structure after nucleosomes requires that the…

A: Relevant genes within the DNA complexed with the histone may be activated or silenced when histone…

Q: DNA structure from least to most condensed. Chromatin Chromatid Nucleosome

A: Condensation of the DNA is required to pack up the genetic material so as to pack the huge amount of…

Q: When studying living cells in a laboratory, researchers sometimesuse drugs as a way to cause cells…

A: A sequence of stages known collectively as the cell cycle are actively separated by eukaryote cells:…

Q: It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of…

A:

Q: describe the appearance of DNA, spindle fibers and location of the chromosomes

A: Cell division is an important part of cell biology. It is the process by which a single cell divides…

Q: Mach the terms left with as many terms GMP Nucleotide at right by entering @ Nucleoside 3 Z-DNA…

A: Thank you for your question,  Here is the answers for the above match the following with…

Q: A patient who has been diagnosed with cancer has been given a blood test in order for their doctors…

A: Cancer is the umbrella term for a group of diseases. Any of the body's cells tend to divide without…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: