Q: Recombination frequencies between four genetically-linked loci in corn are shown in the following ta...
A: WRLQ is the order of genes on the chromosome.
Q: Compare 2 types of Cell Muscle Pancreas Describe a heart muscle cell Describe a pancreas cell 1. Org...
A: The heart consists of cardiac muscle cells or myocardium. Cardiac muscle cells are located in heart ...
Q: A peptide tag on a protein is important for the protein to move to its final destination. the protei...
A: We are supposed to answer one question according to our guidelines. Please repost the other question...
Q: Label the parts of the Aristolochia Macrophylla in the photo given.
A: Aristolochia Macrophylla: Aristolochia Macrophylla is a woody, deciduous and climbing vine found in ...
Q: What technique would you employ to analyse the microbiome found in a human gut? Briefly describe how...
A: Mictobiome is the types and number of microbes present in inside the gut. The information of microbi...
Q: What is one way mitosis is different from meiosis? Mitosis produces two cells with 46 chromosomes O ...
A: Cell is elemental unit which undergo numerous Metabolic process and also cross the process of splitt...
Q: what effect would destaining with ethanol for one minute have on your judgment of the gram reaction ...
A: Gram staining is a differential stain which differentiate bacteria into two groups gram positive and...
Q: Last year you sampled a population of asters in the Rochester area and the allele frequencies for on...
A: If the population is in the Hardy-Weinberg equilibrium then the allele and genotype frequencies will...
Q: Cellulase is an enzyme that breaks down cellulose in the digestive system of some insects such as te...
A: By decreasing the activation energy of a biological reaction, enzymes play a role in catalyzing it. ...
Q: In mice, the presence of a dominant A allele results in the agouti pattern of fur color, whereas the...
A: In genetics, certain alleles are dominant over other. The alleles can be homozygous or heterozygous....
Q: Why are decomposers and detritivores essential parts of all food webs
A: Food chain consists of producer, primary consumer and secondary consumer and tertiary consumers.
Q: Answer the Guide Question: a) Each cell in an organism has all of the basic parts. Each has a funct...
A: Each cell in an organism has all of the basic parts. Each has a function that benefits the other cel...
Q: Explain how DOMINANT, INVASIVE, and KEYSTONE SPECIES affect thier community?
A: Different types of species affect their community in different ways.
Q: Why is it important to become familiar with the microbiology laboratory's apparatus and equipment?
A: You should always know your lab equipment well before you do any type of experiment because without ...
Q: Bacterial species that are harmful, as well as others that are beneficial, are found living in the h...
A: Antibiotic sensitivity testing or antibiotic susceptibility testing is the measurement of the suscep...
Q: How do cells know what proteins to make and how? O Mitosis O Protein Synthesis O Meiosis Genes
A: The biomolecules are the major components of the cell that perform all the functions of the cell. Pr...
Q: uring which phase of cellular respiration is the majority of ATP formed
A: During which phase of cellular respiration is the majority of ATP formed? Answer. Electron transport...
Q: 2. The proper definition of the ecological niche (role) of the gray wolf (Canis lupus lupus) is: A. ...
A: The correct answer is option A:- it specializes as a predator of large mammals, and some smaller mam...
Q: 3. Sympatric speciation, in which the ancestral and descendant populations occupy exactly the san ge...
A: Sympatric speciation is the evolution of a new species from a surviving ancestral species while both...
Q: A potbellied malnourished child with some body fat who just consumes rice and sweet potatoes all day...
A: A. Kwashiorkor, marasmus
Q: Why is trypsin an unusual name for an enzyme? (What is the convention for enzyme names?) .
A: The enzymes are the biocatalyst that perform specific biochemical reaction within the body and after...
Q: Which of the following is a reason that scientists do not classify viruses as living things? A. The...
A: Qusstion - Which of the following is a reason that scientists do not classify viruses as living thin...
Q: A correlation coefficient of -0.92 indicates that... Two variables strongly change with one another ...
A: The coefficient of correlation depicts the relationship between two variables.
Q: Explain how N-linked glycans participate in protein folding and quality control.
A: Protein synthesized by ribosomes associated with the membrane of the Rough endoplasmic reticulum ent...
Q: Describe how aspirin affects the action of platelets.
A: Platelets are small, colorless fragments that form clots and prevent excess bleeding. These are comp...
Q: For the successful biological control on prickly pear, which of the following statements is INCORREC...
A: prickly pears are native only to the Americas 1768 prickly pear entry into Australia 1926 the fir...
Q: How do ecology and esvironmentaliam differ?
A: Humans rely on ecosystems for a variety of unseen services. For example, ecosystems provide foods, m...
Q: Can you figure out which valve would this (black arrow) be? (Hint: Follow the direction of blood) co...
A: The heart of mammals generally consists of four valves that are mitral valve, tricuspid valve, and, ...
Q: Why do we need to identify and determine the function of every single molecule involved in cell sign...
A: Cell signaling is an important aspect of biological life. It allows cells to detect and respond to ...
Q: 5. Identify the materials cycle being disrupts in the following human activities. a. deforestation- ...
A: Introduction Soil ecosystem is an example of complex ecosystem as it contains a lot of living, non-l...
Q: Label each phase and describe what is happening to the DNA. Interphase, Prophase, Metaphase, Anaphas...
A: In cell biology, Cell division is defined as the division of the cells into two daughter cells for g...
Q: Peto's Paradox states that the incidence of cancer is directly correlated with the number of cells i...
A: As per the guidelines we are supposed to answer only first question, in case of multiple question po...
Q: KEY QUESTIONS 1. Energy is said to flow in a "one-way" stream through an ecosystem. In your own word...
A: Energy flow is the key function in the ecosystem. The storage and expenditure of energy in the syste...
Q: The mutation to the pelvic switch region also meant that the Pitx1 gene was only partially functiona...
A: In humans, Pitx1 gene encodes a protein called the paired like homeodomain 1.
Q: Do genetic differences ever occur in asexually reproducing organisms? If so, how?
A: There are two different modes of reproduction namely, asexual reproduction and sexual reproduction. ...
Q: codes for a protein that improves the nutrient value of the food
A: Genetically engineered organisms are those which contain genes from some foreign organisms.
Q: 5. What is the average percentage of warrens attacked in each soil type. Soil type Average percentag...
A: Predation T is a kind of relationship between two different species where one species kill other sp...
Q: You are analyzing the activity of the protein p53 in two different cell types. You notice that p53 h...
A: The function of a protein is primarily related to its structure if the composition of protein is sam...
Q: List 2 functions of peripheral membrane protein
A: Peripheral membrane protein - it is the membrane proteins adhere only temporarily to biological memb...
Q: The mutation to the pelvic switch region of the Pitx1 gene affected which stage of the gene expressi...
A: The PITX1 gene gives instructions for manufacturing a protein that is important in the development o...
Q: True or False: A normal red blood cell is labeled in the picture above. The other cell is shriveled ...
A: Solution is made by the combination of solute molecules with Solvent. Solution = Solute + solvent S...
Q: Green algae and plants differ in which of the following? Algae have alternation of generations but l...
A: Plants are mainly eukaryotes, phototroph, multicellular organisms and photosynthetic organism. Algae...
Q: The wingless fruit fly phenotype (unable to grow wings) is recessive to normal wing growth. A wingle...
A: The wingless male fruit fly is crossed with a wingless female fruit fly and the progeny produced by ...
Q: ADP ribosylation is one example of post-translational modification of an enzyme. Which statements ab...
A: Introduction:- ADP-ribosylation is a reversible kind of post-transcriptional modification of the pro...
Q: Current dietary recommendations to reduce the risk of coronary heart disease include all of the foll...
A: Healthy food habits are essential for a healthy body. So we need to take precautions to have food th...
Q: To the Bartleby Expert: How would you describe the slope of a rank abundance curve that vary with in...
A: Community is highly essential and includes various aspects such as kinship, togetherness, and identi...
Q: (2) Design an experiment on how would molecular genetic tools, such as DNA microarrays, be used to s...
A: DNA microarray is a molecular technique used to compare the expression of many genes simultaneously....
Q: In a certain plant, the orange flower allele (Y) is dominant to the yellow flower allele (y). An all...
A: Given that, in a certain plant, "Y" allele produces orange flower and is dominant over allele "y" wh...
Q: Correct Answer: b. 1/8
A: The chances of gamete will only contain chromosome of maternal origin is 1/8 percent
Q: function of the skeletal system
A: The skeletal system is of two types that are exoskeleton and endoskeleton. The exoskeleton can be of...
Label the 5’ and 3’ ends of both strands
Step by step
Solved in 2 steps with 1 images
- The arrowheads represent the 3’ ends of the strandsWrite the name of disease occur due to Nonhomologous End Joining Repair.On diagram A: label the 3’ and 5’ end. is this strand more likely DNA or RNA. Why? On diagram B label: one purine one pyrimidine On diagram C draw the appropriate number of hydrogen bonds between the base pairs
- The _____________ strand is made continously.Directions: Given the DNA strand below. Decode the hidden message in the proteins that will be produce in protein synthesis of the given DNA strand. Identify the (1) complimentary DNA strand, (2) mRNA, (3) tRNA, (4) amino acid sequence, and (5) protein. Use the 1-letter symbol of the amino acids to produced to decode the message.Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandFill in the following tableWhen referring to bacteria cells, a plasmid is not naturally occuring. is the large bacterial chromosome contained in the nucleoid. is a small, circular double-stranded DNA molecule that replicates autonomously. is composed of double-stranded RNA. does not code for proteins.
- can you please only do the part " Show DNA replication using the following DNA Strand: AAT CAT GGG CCA "which letter dipicts leading strand A. J B. B C. K D. LAcetocarmine is a natural stain that comes from an insect. This stain binds to chromatin and stains it red. DNA in eukaryotic cells is packed with proteins to form a structure called chromatin; thus it is useful for identifying nuclei. Draw a cell from a potato and label what would be stained with acetocarmine.