For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: what is the adenine content

A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…

Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'

A: Central dogma consists of replication, transcription and translation.  Replication is the synthesis…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.

A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…

Q: Convert the following sequence into protein strand using one letter code:…

A: The protein is made by the post-translational modification of peptide chains, and these peptides are…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO…

A: Deoxyribonucleic acid (DNA) is a double helical structure, which is composed of nucleotides. The two…

Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?

A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…

Q: One DNA strand has the sequence  5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: 10

A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.

Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC   Give the RNA…

A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Using the complementary base pairing rules in DNA, complete the following base pairs: 3D Adenine -i…

A: According to the complementary base pairing rule in DNA- Adenine and Thymine are complementary to…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and…

A: Given:  A piece of the partially double-stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA…

Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…

A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: Which of the following statements are true about double-stranded DNA? Write TRUE or FALSE 1. A+G=C+T…

A: DNA is a double stranded molecule with complementary base pairing. Complementary base pairing occurs…

Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…

A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…

Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…

A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3'   i)…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for…

A: DNA replication: It is a process of producing two identical replicas of DNA for one original DNA.

Q: Which type of information about the nucleotide sequenceof the target DNA is required ?

A: Targeted sequencing is defined as a process in which there is a rapid as well as…

Q: Why is it easier to separate the strands of a DNA molecule at pH > 11?

A: The power of hydrogen ion concentration is defined as ph. The pH drops below 7 when the H+ ion…

Q: polynucleotide strand has the bases G, T, C, and T, starting from the 5’ end. Assuming this is a DNA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: If one strand of the DNA double helix consists of T-C-G-A-T-G-T-A, what is the sequence of the…

A: Introduction DNA ( Deoxyribonucleic acid) and RNA( ribose nucleic acid). These are the nucleic acids…

Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…

A:

Q: Which of the following DNA sequences will travel the shortest amount down a gel? A ATTGCAGGCCT B…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…

A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: If one of the strands of DNA has the following sequence of bases running in the 5-S3'…

A: The given strand is: 5'-G-G-A-C-A-A-T-C-T-G-C-3` The complementary strand for the given sequence is:…

Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…

A: DNA is the protein in all living organisms that convey genetic information.

Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.

Q: Write the base sequence in a complementary DNA segment if each original segment has the following…

A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…

Q: If one side of a DNA molecule has the base sequence A T C G G G C C A A C C, what would the sequence…

A: According to watson and crick pairing in DNA, A (adenine) forms 2 hydrogen bonds with T (thymine)…

Q: Assuming the presence of the complementary strand, what is the percentage composition of the polymer…

A: When one strand of DNA is used as a template to create a new strand, the complementary strand is…

Q: If a DNA double helix that is 100 base pairs in length has32 adenines, how many cytosines, guanines,…

A: According to the given question above, there are a total of 100 base pairs in length. There are 32…

Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…

Q: For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below…

A: Given: a sequence of amino acids, serine-valine-lysine-leucine

Q: Match the correct bases pairs to find the opposite strand of DNA strand of       DNA -  T  G  C…

A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG  is TACTAATAGGATATC.

Q: Convert each of the following 3′-to-5′ DNA base sequences to 5′-to-3′ DNA base sequences. a. 3′…

A: Introduction DNA is a directional molecule because each of its building block (nucleotides) have 5'…

Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.