Write the name of disease occur due to Nonhomologous End Joining Repair.
Q: Explain the connection between defects in DNA repair systemsand the inherited human disease…
A: Genetic disorder It is also called as inherited disorder and is caused due to, Chromosomal…
Q: A piece of DNA ejected by a bacterial cell through a tube-like passage through the cell wall is…
A: Bacterial cells divide by binary fission in which one parent cell divides into two identical…
Q: hich repair mechanisms is most require to fix thymine dimers? BER NER mismatch repair…
A: When many proteins and RNAs are damaged, they will be degraded and sugars, are metabolized in order…
Q: What do you mean by Error-Prone Repair by Nonhomologous End Joining?
A: Non-homologous end joining (NHEJ) is a pathway that repairs double strand breaks in DNA. NHEJ is…
Q: Label the DNA structure below.
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Name the disease occur due to defective Nonhomologous End Joining Repair.
A: There are four phases of cell cycle G1, S, G2 and M. Most of the DNA repair occur in G1 phase of…
Q: Given the following enzymes, fill up the table. You may repeat answers in each column. Replication…
A: Central dogma Central dogma involves the process that encodes the functions of a gene leading to…
Q: Letter 'd' corresponds to 5' 5' 3' origin of replication. primer. O replication fork. O Okazaki…
A: The Central Dogma theory states that DNA makes RNA and RNA makes proteins. DNA replication is the…
Q: D 5. Choose the letter that corresponds to the step in the process where a restriction enzyme is…
A: The letter that corresponds to the step in the process where a restriction enzyme is used - Step A.…
Q: Provide a detailed description and hand drawn figure of each of the following. (1) Mismatch…
A: Although the genetic variation is important for evolution, the survival of the individual demands…
Q: Single nucleotide polymorphisms are found ina. DNA. b. RNA.c. plasmidsd. siRNA
A: Introduction:- Single nucleotide polymorphisms are defined as loci with alleles that differ at a…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at…
A: The DNA molecules that encode its genome in human cells DNA damage is subdivided into two types:…
Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…
A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…
Q: G>
A: DNA stands for deoxyribonucleic acid. It is the genetic material in the cell.
Q: Draw a replication origin in E. coli. Place the first 4 primers in the figure. Show how the…
A: Answer :-
Q: Cxikeria DNA Transcription Translation Location
A: The central dogma, central to the cellular process functions in transcription by conversion of DNA…
Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…
A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…
Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Telomeres…
A: DNA is the genetic material that exists in every cell in your body . This DNA is wrapped up with the…
Q: Detail the differences between base excision repair and nucleotide excision repair. Please help…
A: The damaged DNA is repaired as required because mutated DNA is not allowed to enter the cell…
Q: Semi-conservative replication:
A: DNA refers to deoxyribonucleic acid. It is the genetic material in almost all organisms, except some…
Q: EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'…
A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the…
A: A virus may be a variety of virus that infects bacteria. In fact, the word "bacteriophage" virtually…
Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…
A:
Q: The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes…
A: Mutation: It is a heritable change in the genetic material of an organisms that give rise to…
Q: Compare and contrast F+ x F- and F' x F- conjugation.
A: In Bacteria there are different methods of gene transfer,it occurs between two different chromosomes…
Q: A point mutation could be caused bya. depurination.b. deamination.c. tautomeric shift.d. any of the…
A: A mutation that could only affect a single nucleotide of the nucleic acid is known as a Point…
Q: Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
A: Deoxyribonucleic acid or DNA is a nucleic acid that composed of two polynucleotide chain that is…
Q: Define the following terms: a. DNA typing b. short tandem repeats c. DNA profile d. nucleosome e.…
A: a. DNA typing: DNA typing can be defined as the procedure in which variations in the DNA strand is…
Q: Define the following terms: a. transfection b. replicative transposition c. composite transposition…
A: Note: Since you have posted a question with multiple subparts, we will solve the first three…
Q: explain topic is about how recombinant DNA is made
A: In this method DNA from two different species is isolated and inserted into a host organism to…
Q: The type of DNA replication error illustrated in the diagram below is _______________________
A: Frameshift mutation .
Q: Define the following terms:a. RFCb. DNA glycosylasec. apurinic sited. apyrimidinic sitee. mismatch…
A: Introduction:
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: ive the SIGNIFICANT difference between the terms provided in the table below.
A: Somatic Mutation Germline Mutation It occurs in the non-germline cells i.e. except…
Q: Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding…
A: Introduction:
Q: From the sequence given below, provide the ff: 2. ATGT 1. DNA Complement: 2. RNA strand: -- --- L---…
A: DNA contains the genes which is the marker for an organism. Gene expression varies from individual…
Q: Write a short note on replication of DNA.
A: DNA replication is semi-conservative and bidirectional. It occurs in S-phase of cell cycle. details…
Q: Choose all minor nucleosides Anenosin-cyclomonophosphate Thymidin Pseudouridin Pyromycin
A: Nucleosides are the compounds made up of nitrogen base and sugar residues. Minor Nucleosides are…
Q: draw structure of plasmid
A: The plasmid is the extrachromosomal deoxyribonucleic acid (DNA) that is present with the bacterial…
Q: RNase H will remove ribonucleotide directly linked to the DNA end. True false
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…
A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…
Q: Please answer part 1A and 1B please I will upvote then with a proper explanation for the correct…
A: Micro satellites are short short DNA segments usually 1 to 6 base pairs that is repeated multiple…
Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…
A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…
Q: Define the following terms: a. transposition b. DNA glycosylase c. apurinic site d. apyrimidinic…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…
A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…
Q: What is the DNA complement to this DNA sequence: TGAGCCTTAGGA? O UCTCGGUUTCCT O ACTCGGAATCCT O…
A: The DNA (deoxyribonucleic acid) is genetic material of an organism that it inherits from the parent…
Q: Define the following terms: a. processivity b. replisome c. exonuclease d. DNA ligase e. replicon
A: DNA represents the genome of a variety of organisms and can exist in single-stranded or double…
Write the name of disease occur due to Nonhomologous End Joining Repair.
Step by step
Solved in 2 steps
