Give an example of a concrete situation, in the human body, which would lead to DNA replication and another example of a concrete situation, which would lead to transcription/translation of DNA

Q: Let's take the example of the gray kangaroo (Macropus fuliginosus) whose ploidy is 8 and the sexual…

A: Karyotyping is a cytogenetist’s procedure of photographing chromosomes in order to ascertain an…

Q: What is the average radius of a piece of double-stranded DNA in water that has a link length of 5.9…

A: f the link length of the double stranded DNA is 5.9nm so the complete length would be 17813445.2 nm…

Q: ITEM MSM MICROBIAL PROFILE I MICROORGANISM/CAUSATIVE AGENT A GRAM REACTION B OXYGEN REQUIREMENT с…

A: Introduction  Candida glabrata, formerly Torulopsis glabrata, is a haploid yeast species of the…

Q: Which of the following statements is false?a. Auxin and gibberellin promote stem elongation.b.…

A: Introduction :- Abscisic acid (ABA) is a major hormone involved in tuning responses to a variety of…

Q: If an oligosaccharide is attached to a protein via an O-glycosidic linkage which amino acid…

A: The glycoproteins are formed by the joining of oligosaccharide with protein. The glycoproteins are…

Q: How would poor oral hygiene impact a person's teeth? (easy and simple)

A: Oral hygiene is the activity of brushing one's teeth (dental hygiene) and cleaning between the teeth…

Q: What sort of cellular changes would you expect a sailor sick with scurvy to experience? O Their…

A: Introduction: Vitamin C insufficiency is known as scurvy. Anemia, debility, tiredness,…

Q: Q1- The kidneys sit in the back of abdomen O TO 4 and to13 OTO3 And To12 O To 3 and To11

A: The kidneys are two bean-shaped organs, each about the size of a fist. They are located just below…

Q: A B Blood vessel A supplies two body organs namely the and the

A: The given diagram shows an amphibian circulatory system. The circulatory system is responsible for…

Q: 33. Which of the following proteins facilitates the transport of neurotropic viruses to cell bodies…

A: The nervous system is made up of the brain, spinal cord, cranial nerves, and spinal nerves. It is…

Q: The reason that why mycorrhizae might have been important in the colonization of terrestrial…

A: Mycorrhizae is a gerenally define that they are been symbiotic relationship between fungi and plant…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: If you were able to watch a ribosome move along a mRNA by one codon, which of the following would…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: Imagine you work for an industrial chemical company and you have been asked to design a novel…

A: Q. Imagine you work for an industrial chemical company and you have been asked to design a novel…

Q: A) How would you classify the joints between the bodies of the vertebrae based on movement? [freely…

A: The Skeletal system and management in the body gives the body, a particular shape, strength and…

Q: The best example of a population in the list below is the     a tiger salamander tadpoles in 2006.…

A: A population comprises individuals of the same species. Population of different species together…

Q: You set an experiment with amoebae and treated them with cytochalasin B, which is an inhibitor of…

A: Actin forms the cytoskeleton of cell ,and plays a major role in formation of pseudopodia which helps…

Q: To determine: The evolutionary trends in the life cycle of plants also emphasize on the relative…

A: The change of a species' defining feature over numerous generations is referred to as evolution.…

Q: All of the following regarding CD1a, b, and c are true except _____. a. They have a more limited…

A: CD1d presents the lipid antigen to Vγ:Vδ1 T-cell receptors.

Q: In our body, an enzyme called ______________ help break the bond between two monosaccharides when…

A: Digestive enzymes are proteins which aid in the digestion of food. The saliva glands and cellular…

Q: S1 heart sounds (“lub”) represent the closing of the

A: Heart is the main pumping orgen of circulatory system and vital organ of body. Contraction and…

Q: Plant hormones______ . a. trigger the same responses in animals and plants b. are cues for tropisms…

A: Introduction  Plant hormones are signal molecules produced by plants and present in extremely low…

Q: Which of the following technologies can best differentiate between a diploid wild banana and a…

A: Edible banana have either 22 , 33 or 44 chromosomes that represent diploid , triploid and…

Q: Please give me 1.the definition of vaccine and 2.advantages and disadvantages of vaccines

A: Introduction: After inoculating a 13-year-old child with vaccinia virus (cowpox) and demonstrating…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: MASP2 C4b C1r FactorB C1s

A: C2 binds C4b, which results in formation of the C3 proconvertase C4b2. C2 within C4b2 is…

Q: Explain about information gap of Adaptation of species to changes in the environment ( livestock )

A: A genetic modification that helps an organism's survival in its environment is referred to as…

Q: (f) Parts of a Neuron A Axon (initial C E B segment) G H Synapse: The region where an axon terminal…

A: Neurons (also known as neurones or nerve cells) are the basic units of the brain and nervous system.…

Q: What will you do on an exam or problem set regarding fungal genetics if the longest distance is…

A: Microbiology is the branch of biological sciences which deals with microorganisms. Microorganisms or…

Q: C-reactive protein interacts with A) factor D B) C1 C) factor P D) C4 E ) C2

A: Complement system includes components which are made up of proteins or glycoproteins. These are…

Q: Explain what happen during anaerobic

A: INTRODUCTION The anaerobic organisms during their cellular respiration the don't use oxygen for…

Q: 13 12 15 14 11 16 10

A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo out of…

Q: Who originally deserved Kudos for genetic engineering

A: Genetic engineering, often known as genetic modification or genetic manipulation, is the use of…

Q: * Chemical waste is considered hazardous if it has one of the following properties except: Flammable…

A: Chemical waste is considered hazardous if it has one of the following properties except: ?

Q: biology professor at a prestigious university stated to his introductory class that “Today, a basic…

A:

Q: Explain structural adaptations necessary for the invasion of dry plants and also state which…

A: To survive against the drought conditions various plants undergo structural modifications. Some of…

Q: How do HIV criminalization laws conflict with the medical evidence on how HIV is spread. In the…

A: The human immunodeficiency virus (HIV) is an infection that targets the immune system, primarily CD4…

Q: ake the example of B-thalassemia, an autosomal recessive genetic disease that particularly affects…

A: A point mutation is a change in the single nucleotide pair of DNA.

Q: Which of the three 20-amino-acid sequences listed below in the single-letter amino acid code is the…

A: Introduction :- The method of finding the arrangement of amino acids in proteins and peptides is…

Q: A transmembrane protein has the following properties: it has two binding sites, one for solute A and…

A: Introduction :- Conformational changes in single polypeptides are caused by changes in main chain…

Q: 32. A lesion of the right fasciculus gracilis at C-5 is most likely to result in loss of which of…

A: A lesion of the right fasciculus gracilis at c-5 is most likely to result in loss of vibration sense…

Q: Q2- Hight blood presser usually has O Symptoms O No warning signal O Warning signal

A: Introduction  The pressure of circulating blood against the walls of blood vessels is known as blood…

Q: hy  the MMR is important and evaluate the effectiveness of the vaccine for infants

A: The technique of generating immunity to an infectious organism is known as immunisation. Infants and…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it  is 15 nucleotide long however on gels there are only 10 bands are present…

Q: 3 00 kl c. nondisjunction d. meiosis I O e. meiosis II enetically male 8-week-old fetus that…

A: In 1st diagram pairing of homologous chromosomes takes place. Chromosome number is 4 In 2nd…

Q: The antibiotic erythromycin works by blocking ribosomal movement (translocation) along an mRNA, in…

A: Introduction: One of the most prevalent antibiotic mechanisms of action is translation inhibition,…

Q: Adenosine Triphosphate (ATP) is the energy currency of the cell in any metabolic activity of the…

A: Adenosine triphosphate (ATP) is a three-phosphate nucleotide. The addition of phosphorous to the…

Q: 6. Which are responsible for the template in the synthesis of proteins which in turn control the…

A: The protein synthesis takes place in the cytoplasm of the cell. The protein synthesis activity and…

Q: Question 1 A. What conclusions can you draw concerning the paternity of Puppy #2? Please explain.…

A: DNA fingerprinting is a test used in forensic labs which determines the genetic makeup of the cell…

Q: During digestion we produce energy by converting large complex molecules into smaller simpler…

A: Introduction :- Digestion is the process by which large insoluble food molecules are broken down…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.