Q: What is a phylogenetic tree?
A: A phylogenetic tree, also known as an evolutionary tree or a cladogram, is a diagrammatic…
Q: List two advantages of using sequence analysis of ribosomal components in classification?
A: A ribosome is a cellular structure involved in protein synthesis, which is a fundamental process in…
Q: Word Definition organisms the gain energy from sunlight and carbon from CO₂ organisms that gain both…
A: A photoautotroph is a plant that's also a solar chef. It's an organism that uses sunlight to cook…
Q: a. Phylogenetic relationships based on chloroplast genes Brown algae Diatoms Most photosynthetic…
A: Chloroplast is an organelle which is responsible for photosynthesis. It was acquired by a bigger…
Q: In individuals with hereditary alkalosis, common symptoms include the accumulation of HCO)…
A: Chloride bicarbonate anion exchanger protein helps in the exchange of chloride and bicarbonate ions…
Q: Using the readings in this module and the previous assignments, establish your knowledge of how food…
A: Food resources include food items that humans consume in order to meet their physiological needs and…
Q: a Macmillan Learning b с
A: Organisms a and b are algae.Algae are simple, chlorophyll-bearing photosynthetic non-vascular…
Q: PLEASE DO BAR GRAPHS BASED ON DATA: Procedure: Assuming both parents carry three tall genes and…
A: We'll recreate the inheritance of tallness for 10 particular kids, expecting that both parents…
Q: The genetic map shows the location of three genes on a chromosome. Order the gene pairs based on…
A: The sequential assignment of loci to a relative position on a chromosome is known as gene…
Q: There are many compounds that have been advertised to reduce or delay aging. Resveratrol is a…
A: Resveratrol is a compound found in red wine and other plants that has been shown to have a variety…
Q: lon concentrations inside and outside of a typical mammalian cell are not the same. Which of the…
A: Ions are necessary for cellular activity. They participate in a wide range of crucial physiological…
Q: The sympathetic postganglionic neurons release only norepinephrine while the adrenal medulla…
A: A sympathetic postganglionic neuron is a type of nerve cell in the autonomic nervous system that…
Q: Why is the following statement fals? RNA polymerase is a dangerous enzyme to the cell because it…
A: RNA polymerase is an essential enzyme that catalyzes the transcription of DNA into RNA. It is a…
Q: Which of the following statements is true? Cholesterol tends to gel the liquid crystalline state of…
A: The plasma membrane also called cell membrane is a structure that separates the interior of the cell…
Q: Discuss the types of dentition as to: Attachment Replacement Size and shape of crown
A: Dentition refers to the arrangement, development, and characteristics of teeth.Different species…
Q: Use Verbal description of results from graph and then Interpret the graph for Novice vs. Exprienced…
A: Forgaing means relying on food that is provided by nature through the gathering of plants and also…
Q: Exercise 6: Sex-Linked Traits (XX) and males have an X and Y chromosome. During meiosis, sex…
A: Haemophilia is X linked recessive disease meaning mutation in one of the X chromosomes in males…
Q: What skeletal elements do anthropologists rely on to estimate sex? Keep in mind that these are…
A: The objective of the question is to identify the skeletal elements that anthropologists use to…
Q: Q1. Explain the relationship between each of the following and the risk of a contamination event…
A: The risk of a contamination event can vary widely depending on the specific circumstances and the…
Q: How did you know that Paclitaxel was inhibiting cell division? What method of observation was used…
A: The investigation into the effects of Paclitaxel on cell division is a critical aspect of cancer…
Q: 7. Which of the following are RNA sequences? Check all that apply. Na promoter ferritin trp operator…
A: The question pertains to identifying which of the given options are RNA sequences. The options…
Q: For a neutrophil to phagocytose a bacterium, it must have: For a neutrophil to phagocytose a…
A: Neutrophils are a type of white blood cells. They contain granules and are called granulocytes. They…
Q: Bb. na are also ca a. What is the probability that they will have a child affected with CF?…
A: Monohybrid crosses occur when only one characteristic at a time is taken into consideration whereas…
Q: Which of the following scenarios are the result of codominance? You may select more than one choice…
A: The question welcomes us to dive into the fascinating world of genetics, particularly focusing on…
Q: 7. Instead of one big square it is much easier to make two small Punnett squares, one for each gene.…
A: The inheritance of an "A" or "a" allele is not influenced by the inheritance of a "B" or "b" allele…
Q: Select terms from the Answer Bank to label the diagram according to hypothesis 1 on the origin of…
A: The diagram shown above indicates about the origin of eukaryotic cells. It is first proposed by Lyn…
Q: The last thing we want to know is: assuming junipers could be a large source of bagworm larvae, does…
A: A hypothesis in statistics is a verifiable assertion or proposition regarding a population or a…
Q: Describe the process by which an integral membrane glycoprotein goes from mRNA to being an integral…
A: Protein synthesis is a very coordinates and complex process involving multi steps. It involves…
Q: Sordaria fimicola is often used to demonstrate arrangement of colored ascospores within an ascus…
A: Sordaria fumicola is an ascomycetes fungus that is used to study the crossing over and recombination…
Q: Answer the following question in few paragraphs: The actual network and the microtubule network…
A: In eukaryotic cells, microtubules and actin filaments are crucial parts of the cytoskeleton.…
Q: Which of the following statements best describes the hydrophobic character of bacteriorhodopsin…
A: Bacteriorhodopsin is a light-driven proton pump that is embedded in the cell membrane. This allows…
Q: Suppose a geneticist is using a three-point test cross to map three linked rabbit morphology and…
A: Linkage is the tendency of genes or other DNA sequences that are close together on a chromosome to…
Q: The MARCH-1 E3-ubiquitin ligase is expressed in B cells, dendritic cells, and macrophages. The…
A: Pathogens have evolved various mechanisms to evade the host immune system. One such mechanism is to…
Q: QUESTION 5 What is the role of nonkinetochore microtubules? A. They move the chromosomes to either…
A: This question is asking about the part of nonkinetochore microtubules, which are a sort of…
Q: 1. Somewhat ironically, wholly comprehensive and assuring safety standards are somewhat lacking for…
A: The question explores the realm of personal protective equipment (PPE), specifically focusing on the…
Q: 7. A portion of a wild-type protein is shown below: -His- Thr- Glu- Asp- Trp- Leu His- Gln- Asp- An…
A: A mutation is a change in the sequence of DNA (or RNA in the case of some viruses) that can alter…
Q: 4. Chris and Emma are phenotypically normal but carriers for SCA (gene A). a. What are their…
A: Sickle cell anemia (SCA) is a genetic disorder that affects hemoglobin, the protein in red blood…
Q: Which skeletal traits are used to estimate the age of the deceased? Select ALL that apply. A.…
A: The objective of the question is to identify the skeletal traits that can be used to estimate the…
Q: substance obtained from Willow bark in 1973 was found to reduce fever resulting from malaria, and…
A: Salicylic acid, extracted from willow bark extract in 1973, was discovered to effectively reduce…
Q: 1) Draw chromosomes as an X or /, not decondensed. 2) Since we are focusing on the DNA, do not draw…
A: IntroductionMeiosis is a type of cell division that produces gametes (sperm and egg cells) with half…
Q: Describe and give an example of each of four ways that insects use to communicate with each other.
A: The question investigates the interesting world of insect communication. Insects, despite their…
Q: Identify any ten latest medical terms used/published in journals/magazines/new papers and break them…
A: TermsMeaningReferencePCOS/ PCODPolycystic ovarian syndrome/ Poly-cystic ovarian…
Q: The diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The…
A: Transcription is a process of formation of the RNA transcript from DNA sequence. Enzyme involved in…
Q: In a partial diploid of the genotype I - P+ O+ Z - Y+/ I+ P - O+ Z+ Y+, synthesis of β-galactosidase…
A: The genotype given represents a partial diploid, or merozygote, which is an organism with both a…
Q: 1. If there were only two alleles of TAS2R38 (AVI and PAV) in the human population, what are the…
A: The first part of the question is asking about the possible combinations of two alleles, AVI and…
Q: ____________ inhibits T-cell activation when engaged by CD8-/86 on APC.
A: T cells are a type of white blood cells that are called as lymphocytes. They help immune system…
Q: Select all the characteristics from the answer bank that describe three environmental extremes that…
A: The realm of single-celled microbe is called Archaea. These microbes are prokaryotes since they do…
Q: A geneticist is using a three-point testcross to map three linked Drosophila recessive mutations…
A: In our analysis of genetic mutations, it is imperative to calculate recombination frequencies to…
Q: Select all the statements from the answer bank that are true regarding cyanobacteria. They gave rise…
A: Cyanobacteria are also referred as blue-green algae. These are the group of photosynthetic bacteria…
Q: RNA Polymerase II (Pol II) becomes stably associated with the DNA in the context of the…
A: RNA Polymerase II (Pol II) is an enzyme found in eukaryotic cells. It plays a crucial role in the…
Match the
Step by step
Solved in 4 steps with 1 images
- Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
- 5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template(a) What is the function of helicase in DNA replication?(b) What is the function of DNA polymerase?(c) What are replication forks? Compare and contrast leading and lagging strands. Answer all please4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe the differences between the two - an accurate statement about one form of replication that does not clearly indicate how the other form differs will not answer the qestion in it's entirety).
- Factions in our cells happen in a perfect way , therefore DNA replication is error free True or false ?Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strands of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
- A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…1.What does it mean to say that DNA is replicated by a semiconservative mechanism? Describe the experiment of Meselson and Stahl and how it showed that DNA replication is semiconservative23. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices 1. G 2. C 3. A 4. T
