Which of the following statements is false?a. Auxin and gibberellin promote stem elongation.b. Cytokinin triggers growth of lateral buds.c. Abscisic acid promotes water loss and dormancy.d. Ethylene promotes fruit ripening and abscission
Q: A B Blood vessel A supplies two body organs namely the and the
A: The given diagram shows an amphibian circulatory system. The circulatory system is responsible for…
Q: A)Identify the parts of the vertebra arrows A and B point to. B) Which series of vertebrae does this…
A: The human vertebral column is divided into five regions - cervical, thoracic, lumbar, sacrum, and…
Q: How has continental drift/plate tectonics influence evolution?
A: (According to Bartleby guidelines, only the first question has been answered. Kindly post the…
Q: What is wrong about calculating charge of a polypeptide based on the pKa of individual amino acids?…
A: The polypeptide chain is produced by the joining of amino acids together with the help of peptide…
Q: why is RNA important in a physiology standpoint, and why is it important to know about this for…
A: RNA is Ribose nucleic acid. Its main building block is a nucleotide which is made up of a ribose…
Q: Do you believe were in a mass extinction period right now? Why or why not?
A: A mass extinction is when species are lost much faster than they are replaced. 75% of the species…
Q: MASP2 C4b C1r FactorB C1s
A: C2 binds C4b, which results in formation of the C3 proconvertase C4b2. C2 within C4b2 is…
Q: 32. A lesion of the right fasciculus gracilis at C-5 is most likely to result in loss of which of…
A: A lesion of the right fasciculus gracilis at c-5 is most likely to result in loss of vibration sense…
Q: Hello, thanks for the response. Parts B and C are not answered. I believe the rule is 1 question…
A: VNTR is a type of tandem repeat in a DNA sequence in which a short sequence of nucleotide are…
Q: If the side chain for the amino acid threonine got close to the side chain for the amino acid…
A: The process of translating genetic information from DNA through RNA into protein is called…
Q: 65. Which of the following fibers provides the only output of the cerebellar cortex? A) Climbing…
A: Purkinje cells are the most striking histological feature present in the cerebellum. Dendrites…
Q: Why is Indole more likely to travel through the cell membrane than tryptophan? The image here shows…
A: Any molecule can transfer across a protein free lipid bilayer over a variable period of time due to…
Q: Please answer asap and in short 3. What is the caloric cost of 30 min of running at a VO2 of 1.5…
A: Answer :- To calculate caloric cost, Formula is, Kcal = VO2 (L/min) x RER caloric equivalent x time…
Q: hat kind of information That is the application is derived from polyphasic taxonomy? of polyamines…
A: Taxonomy can be defined as the process of classification on the basis of organisms characteristics.…
Q: When Mendel crossed in his P generation a yellow-seeded and green-seeded pea plants, all the…
A: As in F1 generation,all the pea plants have yellow seeds.This means that In pea plants,allele for…
Q: 2.1. Distinguish anatomical differences between C3 and C4 plants.
A: C3 plants Plants that use the C3 pathway or Calvin cycle for the dark reaction of photosynthesis.…
Q: 27 28 26 25 29. 30. 24 31 23 32 22 33 34 20 P -w² 19 8 15 16 72hr chicken embr Transverse section…
A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo out of…
Q: CRISPR
A: Interestingly, CRISPR-Cas9 could be used to the investigation of treatments of various human…
Q: 28. A 62-year-old man has adenocarcinoma with lymph node metastases in the proximal portion of the…
A: Introduction Cancer is caused due to uncontrolled and abnormal division of the cells of the body.…
Q: What did the virus conclude? , Which virus was used? , How did the virus help in the conclusion?…
A: A virus is a submicroscopic infectious agent that replicates only inside the living cells of an…
Q: Number of medium ground finches 40 30 20 10 0 7.3 7.8 8.3 8.8 Average 9.3 9.8 10.3 10.8 11.3
A: Natural selection is a driving force that causes evolution.
Q: Differentiate quantitative and qualitative types of variables or data, and explain their importance.…
A: •The quantitative data is made for collecting the numerical for use for measure data.. The…
Q: You touch a hot stove and withdraw your hand before you perceive the pain. Identify the neural…
A: Introduction NEURAL PATHWAY:- A series of connected nerves along which electrical impulses travel in…
Q: The cell cycle contains a series of events that control the division of cells. It is controlled by…
A: Introduction: A cell cycle is a series of events that takes place in a cell as it grows and divides.…
Q: The term alteration of generations, which two generations are involved and the way of reproduction.
A: alternation of generations, it is the process by which plant perform two mode of life cycle sexual…
Q: Which of the following bacteria can survive in in temperatures ranging from 390F (40C)---to 990F…
A: Thermophiles Are a type of heat-loving microbe that lives in a variety of ecological niches such as…
Q: To describe the six main taxonomic groups of fungi and also explain the reason that some fungal…
A: As per our company guideline we are supposed to answer only first question. Kindly repost other…
Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…
A: Mutations are perpetual alterations in DNA that can command and change the expression of a gene.…
Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…
A: Here the test cross that produced 1572 offspring was conducted between k/k+ l/l+ m/m+…
Q: A)Identify the bone B)What is the name given to area the arrow points to. C) Name one joint this…
A: The arms are the part of the skeleton, which include the bones of upper arm, firearm, wrist joints,…
Q: Bipedalism has many selective advantages. However, there is one disadvantage to walking on two feet:…
A: The human birth canal is narrower and more tube-like. Due to bipedalism, human mothers have thinner…
Q: Briefly explain, using a concrete example, how allopatric speciation can lead to the appearance of a…
A: New species arise through a process called speciation. In speciation, an ancestral species splits…
Q: Which of the following not a characteristic of immur secondary response? ○ IgG isotype ○ No lag…
A: This is the subsequent immune response after the primary immune response, also known as the…
Q: Should one line of evidence hold more weight than another when we discuss the classification of…
A: Classification of species has made it possible to group species of plants, animals and…
Q: What is the most important reason for evolution of bacteria? Explain briefly. GiG of cancer by…
A: Bacterial evolution has continued over the billions of the years since the precambian time period.…
Q: Foraminifera and coccolithophore shells (calcareous sediments) are more commonly found ______. a.…
A: Ooze Ooze is the sirf deposit of material on the bottom of the water body.
Q: One difference between the 'fishapod', Tikaalik, and the early tetrapod, Acanthostega, is... Group…
A: Tetrapod development began approximately 400 million years ago in the Devonian Period, with the…
Q: In the biological sense of the term (and not psychological!), why can't we say that individuals…
A: The statement individuals do not evolve, populations do is rooted in the (classical population…
Q: Lab Data Tube 1 White Light Volume (ml) 3.3 4.5 5.7 6.8 8.2 сл Time (min) Tube 2 Covered Volume (mL)…
A: Rate of volume change = final volume - initial volume/time × 60 Rate of volume change for tube 1…
Q: Q1- The kidneys sit in the back of abdomen O TO 4 and to13 OTO3 And To12 O To 3 and To11
A: The kidneys are two bean-shaped organs, each about the size of a fist. They are located just below…
Q: To describe how fungi affect the human health.
A: Fungi are heterotrophs, meaning they rely on organic substances for energy and carbon. Nutrients are…
Q: 86. A newly discovered infectious agent is found to have genetic material with the following base…
A: Given base composition of the newly discovered infectious agent - Adenine - 23% Cytosine - 26%…
Q: It seems that the expert answer touches on many points, but does not address the question precisely,…
A: Introduction Proto-oncogenes are a set of genes that, when altered, lead normal cells to become…
Q: Several substances found in nature or within living organisms themselves are essential to the life.…
A: Biochemical substances are the compounds found in living organisms. Cells and other structures of…
Q: Consider a 12-carbon saturated fatty acid, calculate the following: a. number of acetyl CoA b.…
A: Catabolism of fatty acids includes three steps - 1. Activation of fatty acid 2. Beta oxidation 3.…
Q: 35, 34 33. 36 32 38. 37. 31- 30- 39. 40, 29 28 27 26 25 45 43 44 24 23 46 L 22 21 2 20 W 6 18. 16 17…
A: The 72 hours chicken embryo contains a bigger embryonic area and four flexures. It contains a…
Q: In our body, an enzyme called ______________ help break the bond between two monosaccharides when…
A: Digestive enzymes are proteins which aid in the digestion of food. The saliva glands and cellular…
Q: In reference to the following table: F1 ebony flies - 0 F1 non-ebony flies - 560 F1 stubbly…
A: Inheritance is the foundation upon which heredity is built. It is described as the process through…
Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…
A: Introduction Batten disease is also known as neuronal ceroid lipofuscinoses. Batten disease is an…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Which of the following statements is false?
a. Auxin and gibberellin promote stem elongation.
b. Cytokinin triggers growth of lateral buds.
c. Abscisic acid promotes water loss and dormancy.
d. Ethylene promotes fruit ripening and abscission
Step by step
Solved in 2 steps
- The three main parts of a typical mature eudicot seed are the _______ . a. pollen grain, egg, and seed coat b. embryo, endosperm, and seed coat c. megaspores, microspores, and ovule d. embryo, cotyledons, and seed coatWhich of the following is True?a. Ethylene stimulates abscission layers to form.b. Abscisic acid causes abscission layers to form.c. Ethylene is sometimes sprayed on flowers to keep them fresh.d. Abscisic acid stimulates seed germination.Which of the following is false about the phytochrome protein?a. There are two convertible forms.b. It primarly absorbes blue wavelengths of light.c. It is involved in seed germination.d. It is involved in plant sensing of spacing.
- How would a loss-of-function mutation in the α-amylase gene affect seed germination? a. The seed could not imbibe water. b. The embryo would starve. c. The seed coat would not rupture. d. The seed would germinate prematurely.How would plant development change if the functions of the genes SHOOTMERISTEMLESS (STM) and MONOPTEROUS (MP) were reversed? a. The embryo–suspensor axis would be reversed. b. The embryo–suspensor axis would be duplicated. c. The root–shoot axis would be reversed. d. The root–shoot axis would be duplicated.Which of the following is false? A. Oak trees have flowers B. Gymnosperms make pollen C. Ferns have seeds D. Corn plants have rubisco
- Which of the following is true regarding germination? a. Imbibition of water is the first step of germination b. All are true regarding germination c. Shoots emerge first, then roots d. The seed coat stays intact during germination e. Freezing and thawing can help start germinationUnder which of the following conditions would pollen from an S2S5 plant successfully pollinate an S1S5 flower? a. Using pollen from a carpelate flower to fertilize a staminate flower would be successful. b. If the plants used gametophytic self-incompatibility, half of the pollen would be successful. c. If the plants used sporophytic self-incompatibility, half of the pollen would be successful. d. Pollen from an S2S5 plant can never pollinate an S1S5 flower.The phloem of a cactus send hormones to areoles, structures that will develop in to flowers. During this interaction, the phloem works in conjunction with which system?
- Which of the following is the role of iron in plants? A. endosperm development and dehydrogenase activity B. photodestruction of chlorophyll and chloroplast structure C. energy transferring process for photosynthesis and respiration D. regulatory component of proteins and metabolites in roots and leaves1, Choose, Which part of the plant is not included in the shoot systems of plants? a, stem b, leaves c, fruit d, roots 2, Choose, Which of the following is not a plant hormone? a, amylase b, auxins c, gibberellins d, cytokinins. Charles and Francis Darwin discovered that(A) auxin is responsible for phototropic curvature.(B) red light is most effective in shoot phototropism.(C) light destroys auxin.(D) light is perceived by the tips of coleoptiles.