Answered: Give typing answer with explanation and…

Name: Give typing answer with explanation and conclusion In eukaryotes, repr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion In eukaryotes, repressors can function by: Select one: binding to the regulatory promoter blocking DNA polymerase binding binding to the polyA tail blocking ribosome binding

Science

Biology

Give typing answer with explanation and conclusion In eukaryotes, repressors can function by: Select one:

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Similar questions

Draw/Diagram and describe Initiation of Transcription in a typical eukaryote. description should be 1-2 sentences.
Give typing answer with explanation and conclusion Which of the following regions of DNA would you expect to be transcribed. Select all the apply. Marks removed for incorrect selection(s) O a. Enhancer O b. 3' UTR O c. 5' UTR O d. Promoter
Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.
Give typing answer with explanation and conclusion Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? Earliest encountered promoter 5' UTR translation initiation codon splice branch point stop codon 3' UTR Latest encountered
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists of the following sequence of bases: AUGCCAGGUUAUGUCUAG. a. What sequence of amino acids would this translate to? b. Now suppose that a mutation takes place in the DNA so that twelfth base changes from U to G. How does this change the meaning of the 4th amino acid? (I.e., what does it change to?) c. Would the result be a normal protein? EXPLAIN SPECIFICALLY WHY OR WHY NOT.
Give typing answer with explanation and conclusion Explain how the Rb protein functions as a tumor suppressor. use as much detail as possible
To start transcription, RNA polymerase binds to a please explain your answer a.initiator complex b.promoter sequence c.trigger factor d.Rho factor e.Shine-Dalgarno sequence
Compare and contrast the process of transcription and translation in prokaryotes then describe transcription unit.
Give typed explanation Use the diagram representing the typical steps in gene expression and protein formation to respond. All of the following help the cell regulate gene expression during Step 2 of protein formationexcepta)general factors that are required for the RNA polymerase to bind to the promoter.b)repressors binding to the operator preventing the RNA polymerase from progressing.c)specialty factors binding to the RNA polymerase, altering its specificity.d)tRNA that binds to the RNA polymerase in the presence of complementary mRNA.
Draw/Diagram and describe RNA processing in eukaryotes. Where does this take place? description should be 1-2 sentences.
Give typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.