Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists of the following sequence of bases: AUGCCAGGUUAUGUCUAG. a. What sequence of amino acids would this translate to? b. Now suppose that a mutation takes place in the DNA so that twelfth base changes from U to G. How does this change the meaning of the 4th amino acid? (I.e., what does it change to?) c. Would the result be a normal protein? EXPLAIN SPECIFICALLY WHY OR WHY NOT.

Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists of the following sequence of bases: AUGCCAGGUUAUGUCUAG. a. What sequence of amino acids would this translate to? b. Now suppose that a mutation takes place in the DNA so that twelfth base changes from U to G. How does this change the meaning of the 4th amino acid? (I.e., what does it change to?) c. Would the result be a normal protein? EXPLAIN SPECIFICALLY WHY OR WHY NOT.

Name: Give typing answer with explanation and conclusion to all parts What
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 20P: Chromatin decompaction is a preliminary step in gene expression (Figure 29.48). How is chromatin...

See similar textbooks

Similar questions

Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.
Give typing answer with explanation and conclusion Which of the following regions of DNA would you expect to be transcribed. Select all the apply. Marks removed for incorrect selection(s) O a. Enhancer O b. 3' UTR O c. 5' UTR O d. Promoter
Give typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.
Give typing answer with explanation and conclusion In eukaryotes, repressors can function by: Select one: binding to the regulatory promoter blocking DNA polymerase binding binding to the polyA tail blocking ribosome binding
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Give typing answer with explanation and conclusion a) List three eukaryotic gene expression mechanisms that do not occur in prokaryotes. For two of these, give specific examples and the functional outcomes. b) Describe what is meant by the term “RNA silencing”. c) Using diagrams, give two examples of RNA silencing mechanisms and indicate one difference.
Give typing answer with explanation and conclusion Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? Earliest encountered promoter 5' UTR translation initiation codon splice branch point stop codon 3' UTR Latest encountered
Answer the following concisely: a. Where does transcription begin? b. What are the template and coding strands of DNA? c. Why only one strand transcribed? d. Is the same strand of DNA always transcribed?
Which statement/s is/are TRUE about transcription?A. During transcription, DNA polymerase binds to RNA and separates the DNA strands.B. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA.C. RNA polymerase binds only to DNA promoters, which have specific base sequences.D. Promoters are signals in RNA that indicate to RNA polymerase where to begin transcription.E. Transcription occurs in the 3’ to 5’ direction with respect to the growing mRNA strand.
Draw/Diagram and describe Initiation of Transcription in a typical eukaryote. description should be 1-2 sentences.