Given the Fischer projection structure of D-Lasallose below, show the step by step process of converting it to 2 possible Haworth structures and give their systematic name

Q: Denatured protein is in a low energy state. What sort of explanation can you use to rationalize that…

A: Denaturation of protein: When proteins are denaturized, they lose the quaternary, tertiary, and…

Q: 17-21 Is the rea (PEP) a re

A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…

Q: Compare and contrast glycerophospholipids and triacylglycerols(functions, structure), including…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Which of the following enzymes is inhibited as a result of insulin binding to its receptor? glycogen…

A: Insulin regulates the level of blood glucose by stimulating the uptake of glucose from the blood…

Q: In the following reaction, what quantity in moles of CH3OH are required to give off 4901 kJ of heat?…

A: The combustion of methanol (CH₃OH) is an exothermic reaction. During the process, the bonds such as…

Q: true/false: The cofactor ATP is essential in all transamination reactions.

A: Transamination is a reaction which results in transfer of an amino group to a keto-acid in order to…

Q: What are the Essential and Non-Essential Amino Acids? Describe each.

A: An amino acid is an organic compound that contains both an amino (-NH2) and carboxylic acid (-COOH)…

Q: Consider a situation where a mitochondrion contained a defective complex III that resulted in only…

A: Electron transport chain consists of a series of protein arranged in mitochondria membrane and…

Q: describe the experiment that proved chemiosmotic hypothesis.

A: The chemiosmotic model of ATP synthesis states that ATP synthesis occurs by movement of protons…

Q: A scientist is studying the enzyme X which is an important point of regulation in the metabolism of…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: Remaining Time: 07 minutes, 13 seconds. * Question Completion Status: closes a potassium channel…

A: Active transport is the transport of substances across the plasma membrane against their…

Q: 9. PFS in erythrocytes, its biological significance, manifestations and consequences of…

A: PFA or progression-free survival is "the amount of time a patient experiences the diseases but does…

Q: Does the complete oxidation of tridecanoic acid (C13:0) make more ATP than the complete oxidation of…

A: Triacylglycerols are stored form of lipids in the body. When there is a lack of energy and…

Q: A bag of Uncle John's potato chips contains 16 servings. What is the MAXIMUM amount of trans fat…

A: In nutrition, fat is an ester of fatty acids. Fat can be saturated or unsaturated. It can be further…

Q: Describe two reasons why the reaction glutamine synthetase performs is important to the body.

A: Cells can accumulate nitrogen in the form of ammonia from amino acid degradation, photorespiration…

Q: A mixture of lipids containing phosphatidic acid, cholesterol, testosterone, phosphatidylserine, and…

A: Non-polar molecules do not form a hydrogen bond with water can are thus considered hydrophobic.…

Q: Identify which of the following pairs of amino acid residues can have hydrogen bonding between their…

A: Amino acids are the building blocks of proteins. The structure of protein is maintained by many non…

Q: 3. Researchers purified a new enzyme and during an initial characterization determined the Vmax to…

A: Enzyme inhibition is when an inhibitor bind to the enzyme at the active site or another site, which…

Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…

A: DISCLAIMER FOR MULTIPLE  Since you have asked multiple question, we will solve the first question…

Q: 1. Describe five major types of lipids.

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: 1. Classification, structure and properties of higher fatty acids, their biological role.

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: In two of the first three steps of glycolysis: Group of answer choices Phosphorylation reactions…

A: Introduction All living organisms need energy to carry various activities. Once we take food, it…

Q: Which of the following is considered an omega-6 fatty acid?

A: Since animals cannot synthesize omega-6 and omega-3 fatty acids, they must be obtained from their…

Q: Using the information in the following graphs that show activity of phosphofructokinase (PFK) with…

A: Phosphofructokinase is belong to glucose kinase group of enzyme and phosphofructokinase can be…

Q: The hormone cortisol causes activation of pathways that under normal conditions 4. are not active at…

A: Gluconeogenesis is the synthesis of glucose residues from non-carbohydrate sources such as pyruvate,…

Q: The presence of insulin causes the activation of phosphoprotein phosphatase. This leads to the and…

A: PFK-2 indirectly regulates the rates of glycolysis and gluconeogenesis. PFK-2 catalyzes the…

Q: Why are steps 4 and 5 essential to the operation of the PDH complex? They catalyze the synthesis of…

A: Pyruvate dehydrogenase (PDH) complex oxidizes pyruvate to acetyl-CoA and carbon dioxide. It happens…

Q: Name the compound:  1. Lys-Ile-Met-Val   Draw the forms of the amino acid in the solution. 2.…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: Kinetic Parameters of Enzyme-Catalyzed Reactions TABLE 12-1 The Values of KM, Keat, and Keat/KM for…

A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…

A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…

Q: Describe the structural similarities and differences of the following pairs. Identify which of these…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.

A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…

Q: Q10.1:  Answer the following three-part question.  a) Calculate the ΔEº’ for the citrate cycle…

A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…

Q: 31) There are several modes for enzyme regulation. What's the difference between competitive and…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: Which of the following is CORRECT?

A: In the reaction of Glycolysis, the △G values of the three irreversible reactions are : Glucose +…

Q: This is the ATP accounting question. You are limited to the carbon in the following molecules:…

A: After glucose enters the cell, there are two possible fates it can undergo: enter glycolysis,…

Q: 19) Why do enzymes have compact structures? (If enzymes weren't globular, then where would the…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: A certain metabolic pathway can be diagrammed as: X Y A B C D where A, B, C, and D are the metabolic…

A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…

Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Glucagon causes production of which activates Insulin causes production of which activates -

A: Glucagon and insulin are hormones released from alpha and bets cells of pancreas, respectively.…

Q: Calculate the mass of invertase (in mg) and  concentration of invertase (in mM) contained in a…

A: Enzyme Activity =Amount of product formedtime The conventional unit used for assigning enzyme…

Q: Draw structure of Cytosine, Thymine and Uracil and describe the difference in the structure?

A: Nucleotides vs nucleosides Nucleosides are pentose sugar(ribose in the case of RNA and deoxyribose…

Q: Several of the enzymes of glycolysis fall into classes that What reaction participate in many other…

A: Enzymes are classified into different classes based on the nature of type of reaction they catalyse.…

Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…

A: Replication, transcription, translation are the three processes of central dogma of life.…

Q: mo Fill in this table for cortisol, aldosterone, testosterone, estradiol, parathyroid gland hormone,…

A: Hormones are chemical messengers or signaling molecules present in our bodies. They travel in our…

Q: Respiratory acidosis results from hypoventilation (decreased respiratory rate) causing a decreased…

A: All biological processes are pH dependent. Even a slight change in pH can result in a large change…

Q: 5. Thin layer chromatography separates lipids in the following order: hydroxylated lipids, then…

A: The working principle of thin-layer chromatography is the same as column chromatography. A small…

Q: The Z-scheme of photosynthesis produces approximately a 3:2 ratio of ATP:NADPH. How does a C4 plant…

A: In chloroplasts, photosynthesis starts when an electron from PSII's (Photosystem II) P680 reaches a…

Q: 1. Scheme of aerobic oxidation of glucose and energy balance.

A: Aerobic oxidation of glucose is also called cellular respiration. Cellular respiration is a…

Q: The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose…

A: Phosphoglucomutase is the enzyme that catalyze the interconversion between glucose 1-phosphate (G1P)…