Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.
Q: Define optical activity? What is the difference between D/L System of nomenclature?
A: Light is a electromagnetic field. It consists of two different fields. The light waves oscillate in...
Q: Question 29 Sponges A Cnidarians Ancestral colonial protist Flatworms Molluscs В Annelids Nematodes ...
A: Theory and practice of classifying organisms is termed as taxonomic. The word taxis means arrangemen...
Q: In the self of a polygenic trihybrid R1/r1 ; R2/r2 ; R3/r3,use the product and sum rules to calculat...
A: When a self cross takes place between the polygenic hybrid, then: The probability in which only one...
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand...
A: DNA is a double helical molecule.
Q: 4. In pea plants, the round shape (R) is dominant over wrinkled shape (r) for seed shape and tall (T...
A: Mendel who proposed principles of mendelian inheritance
Q: An area(s) of the brain long recognized as crucial to overall arousal and attention is the: left hem...
A: Thalamus plays crucial role in attention and arousal (consciousness level)
Q: Why living things over time have changed?
A: Introduction: Evolution is a change in the characteristics of living things over time.In natural sel...
Q: Fragile X syndrome What are the symptoms or characteristics of this disorder or trait? What is the ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Which one of the following features is common to both RNA and DNA? Contain just four types of bases ...
A: DNA and RNA both are nucleotides that contain genetic information of the organism. RNA is produced f...
Q: Giving details diagram the process of tetrasporic megagametogenesis. Give full details
A: INTRODUCTION It is a process of maturing female gametophyte in plant production. In the female ...
Q: Explain in detail, how did Candida famata contaminate or spoiled the snail meat?
A: Candida famata is a fungus that lives in the snail meat, and while its presence doesn't indicate spo...
Q: Why is the orientation of the bases on the inside of the DNA molecule important to the structure and...
A: DNA is an organic molecule that includes genetic information as well as instructions for protein cre...
Q: Unlike prokaryotes, eukaryotes contain membrane-bound organelles. Which of the following is NOT a be...
A: Eukaryotic cells have membrane-bound organelles such as the nucleus and mitochondria.
Q: 3. A woman has a rare abnormality of the eyelids called ptosis, which makes it impossible for her to...
A: Gene expression is the mechanism through which genetic code is used to create a functioning gene pro...
Q: #5 Explain how and where auroras occur in the atmosphere. #7 Describe the interaction between the at...
A: An atmosphere is a layer of gas that surrounds a planet and is kept in location by the gravity of th...
Q: What are the barriers that affects the mating of species (in relationship with inbreeding)?
A: Introduction :- A species is the biggest collection of organisms in which any two individuals of the...
Q: Which of the following terms are used to apply ONLY TO SELECTION, and never to just evolution. Choos...
A: Founder effect:- the reduced genetic diversity which results when a population is descended from a s...
Q: Examples of bacterial genera that cannot be cultured using artificial media
A: Bacteria usually has very low nutritional requirement and hence can be easily cultured in artificial...
Q: I have parallel leaf veins, flower parts in 3 and a fibrous root system. What am I? Group of answer ...
A: Monocots contains single cotyledon, parallel-veined leaves, scattered vascular bundles in the stem,...
Q: 00 PR 3. Which of the following is characteristic of reciprocal translocation? O a. Parts of two hom...
A: Given: A sudden change cause in a genetic material is called mutation.The mutation may occurs due to...
Q: Define the Regulation of gene expression in bacteria ?
A: All the cells contain genes in them. Genes carry the information on hereditary material. Genes are p...
Q: Study guide 15
A: In sublingual administration the tablet is allowed to dissolve completely in the oral cavity. It tak...
Q: Give the methods of transposition ?
A: Deoxyribonucleic acid or DNA is a hereditary material that transfers from one generation to another....
Q: What are the specific ways in which individuals and environments interact?
A: In this nature, individual and environment are interactive with each other. Interaction is necessary...
Q: How genes store genetic information ?
A: Introduction: Genetic information must be passed on from one generation to another, be it a eukaryot...
Q: If heritability of dots is zero: Group of answer choices Offspring will have no dots. Offspring will...
A: The sum of all biological mechanisms by which certain features are passed down from parents to their...
Q: virion. Describe how the Baltimore classification system classifies viruses.
A: An infectious agent that can only replicate within a host organism is commonly refers as the virus. ...
Q: Where on the tree did Bilateral Symmetry Evolve? O A O B O D O E
A: Few important points : Body symmetry is the similarity of parts in different regions and direction o...
Q: Which of the following protists photosynthesize? Group of answer choices Autotrophs Heterotrophs Mi...
A: According to the question, we have to find out which of the following protists can photosynthesize. ...
Q: In preparying cells for karyotyping, a hypotonic solution is used in the process. What is the purpo...
A: Cytogenetics is the science or study of chromosomes.
Q: 1A) When you have extreme inbreeding (i.e. same genotypes mate to give rise to the next generation),...
A: Introduction A phenotype is a set of observable characteristics about a person, such as height, eye ...
Q: In what way is diversity intrinsically valuable to a population? How is genotypic or phenotypic dive...
A: Genetic diversity refers to the total number of genetic features in a species' genetic composition; ...
Q: Define the role of lactose in induction ?
A: Their are wide range of meaning of induction in biology with respective to branches of biology.In em...
Q: 1. Are Cnidarians sessile or free-living? Does this distinction depend on body type? If so explain 2...
A: According to our guidelines we can solve only first three sub-parts and rest of the questions can be...
Q: HIV what is the genome for the virus? And, what Baltimore class does the virus belong to? does the v...
A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: AIDS...
Q: Pick one biologic material. List it, then explain how it responds to loading. . What properties of t...
A: Biological materials are natural biocompatible materials that make up all or part of a living struct...
Q: Describe how direction is determined in nucleic acids. Also identify the "normal" direction that is ...
A: The nitrogenous bases are stacked in the interior in pairs, like the steps of a staircase; the pairs...
Q: SPLIT DNA mRNA TRNA Codon Anticodon Amino Acid A T C G G C A T A G T A A
A: The DNA is the genetic material that is responsible for the production of RNA transcription process....
Q: Why did the lab technicians need to mechanically crush the microbes and chemically dissolve their ce...
A: Introduction DNA extraction is a technique for isolating DNA from cell membranes, proteins, and othe...
Q: Contrast and compare the mutagenic effects of deaminatingagents, alkylating agents, and base analogs...
A: Mutagens are substances that damage DNA and can cause permanent changes (mutations) in the DNA seque...
Q: Chemotrophic energy metabolism is a catabolic and exergonic process that produces ATP from oxidizing...
A: Chemotrophs are organisms that get energy through the oxidation of electron givers in their environm...
Q: Differentiate the respiratory tract between the Mammals and Avian.
A: INTRODUCTION Differentiation between avian and mammalian respiratory system is given below.
Q: An organism of the genus Staphylococcus is genus Spirochaeta is while and organism of the rod shaped...
A: 1) The shape of streptococcus bacteria is spherical or circular thus they are called as coccus. Whil...
Q: Ascaris is good for chromosomal identification because a. Mitosis occurs every 0.5 seconds....
A: Ascaris is a type of roundworm.
Q: What is cisacting site ?
A: cis means " same side". The cis acting site acts as a site of DNA or RNA which helps in regulating t...
Q: Why is fatigue strength important for metallic biomaterials?
A: A biomaterial is described as a substance that has been designed to take a shape that is utilized to...
Q: 5 7. Cross a parent with IAIA Blood type with a parent IBIB Blood type. What are the phenotypes and ...
A: Blood is the fluid that circulate through our body. There are mainly four types of the blood group f...
Q: Why do we say that life is based on carbon
A: Catenation is a process in which atoms (carbon) are able to form a bond with other atoms of the same...
Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki
A: Note: As Per Guidelines, We Can Answer One Question or 3 subparts per question. Ask Again To get res...
Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?Yes or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr generate linear moleyof dna? in situ hybridization reveals distribution of a gene's mrna in an organism.Fill the blanks correctly. 1. The genomes of chimpanzees and humans are over _________ percent alike. Of the genes that are different is one that is needed for proper ______ development, which probably played an important role in human development. 2. The human genome contains _____ genes, that are translated into _____ different proteins. 3. The cholesterol-fighting drug Lipitor, which is prescribed for patients with high chloresterol levels, works by inhibiting an enzyme needed for the body to manufacture chloresterol. Knkwing the shape of the enzyme helped scientists discover what drug might be able to serve as an inhibitor of that enzyme. This illustrates how proteomics can be useful in developing new drugs for the treatment of disease since enzymes are proteins. Drugs tend to be ______ or small molecules that affect the _____ of _____
- Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system?Pls Help me. 2. If a selection assay be made to identify cells that have incorporated the recombinant DNA, what type of medium will be used? How will it work?Need help 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely target a particular gene with an RNA of this size, consider the following calculation: what is the expected frequency of occurrence of a specific 18 nucleotide sequence? a.The probability of finding this sequence is ___ . b.Therefore, the frequency of occurrence of this sequence is one in ___ nucleotides. c.The fruit fly genome consists of 1.2×108 base pairs.Using the logic in part a., calculate the minimum length of a unique DNA sequence expected to occur by chance just once in the fruit fly genome. Length = __ base pairs
- Please answer fast 1. When a researcher states that two sequences share a conserved region, what principle isinvoked? a. the sequences are homologousb. the sequences are similarc. the sequences share the same functiond. the sequences are homogenous 2. Local sequence alignment algorithms are a better choice than global sequence alignmentfor a. finding homologous DNA elements among distantly related organismsLocal sequence alignment algorithms are a better choice than global sequence alignment b. finding homologous DNA elements among closely related organisms 3. Which of the following sequence alignment programs work by doing local alignments? a. BLASTb. Clustalc. MUSCLEd. T-Coffee 4. The difference between local and global sequence alignments is that local alignmentalgorithms attempt to a. align arbitrary-length segments of the sequencesb. align every residue in every sequenceHELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.Need help fast What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?
- Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and species of the following DNA sequence: TATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATG Gene: Insulin Receptor (INSR), Species: Mus Musculus Gene: Insulin Receptor (INS), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Mus MusculusYes or no? DAPI just stains dna in testes and sperm of planarian. A of riboprobe duryin situ hybridization pair with T's in mrna . T with A, cwith G and G with C. in forward genetics phenotype is known before the gene mutation and in reverse genetics the altered gene is known before phenotypeNeed help fast Explain briefly how bacteriophages causes mutation .