Q: Which of the following is not true of all hormones; May bind with distant target tissue receptors O ...
A: Hormones are chemical messengers that are released from the endocrine glands. They can be proteinace...
Q: HELP PLEASE !! You are looking at a region of the genome that codes for a gene involved in enamel s...
A: ORF finder searches for open reading frames (ORFs) in the DNA sequence you enter. The program return...
Q: Describe in detail the formation of unit cells by type (we studied 3 in class) and the development o...
A: Unit cell: In crystal lattice, the smallest unit or the building block is called unit cell.
Q: To determine the recombination frequency of two linked genes, what genotypes of organisms are crosse...
A: Genes are heredity units present on the chromosome and are meant to transfer genetic instructions . ...
Q: Charles Darwin, himself a proponent of pangenesis, publishes On the Origin of Species his explanatio...
A: Though Darwin wasn't sure of the mechanism by which traits were passed on, he did not believe that e...
Q: Explain the role of β-galactosidase ?
A: Introduction: Genetic expression in bacteria is coordinated by an operon. When Jacob and Monod obser...
Q: an you please help answer this question?
A: the speed of the deer is increased to satisfy their hunger. Some salamander species emerge from thei...
Q: Define about constitutive mutations ?
A: In biology, mutation is the phenomenon in which change in sequence of DNA, alternation in nucleotide...
Q: How do human activities negatively affect biodiversity? Cho A introducing invasive species
A: The three human activities negatively affect biodiversity that apply - introducing invasive speci...
Q: 1. What is Opisthorchis felineus? 2. What is the infective stage or stages of development of Opistho...
A: The cat liver fluke, Opisthorchis felineus, is a trematode parasite which affects the liver of anima...
Q: The kidneys are surrounded by a protective capsule which is composed of
A: The pair of bean-shaped organs located in the abdominal cavity, that are responsible for production ...
Q: Describe the reflex arc mechanism.
A:
Q: Consider the following estimates:(a) There are 7 x 109 humans living on this planet.(b) Each individ...
A: Answer - a) There are currently 1.4×109 mutations present in the human population. this is calculate...
Q: n a given sample of stool in picture. Answer the following question below. 1. What is the quantity? ...
A: A stool analysis is a series of tests done on a stool sample that helps to diagnose certain conditio...
Q: A monosaccharide designated as an aldehyde sugar contains(a) a terminal carboxyl group (b) an intern...
A:
Q: Why is the narrow-sense heritability more useful to plant and animal breeders than broad sense herit...
A: Chromosomes are present in the nucleus of the cell. These chromosomes have a number. The sum total ...
Q: Define gametogenesis
A: The reproductive system is a bodily organ system that includes both male and female reproductive sys...
Q: Select the disease which makes lungs lose its elasticity due to the inflammation of alveoli. A. Lung...
A:
Q: Under conditions where cellular ATP levels are high the rate of electron transport in mitochondria s...
A: Option A-high pH gradient slows proton pumping, which in turn slows electron transport.
Q: List the following to determine the unknown bacteria: Streptococcus mutans 1) Morphology & Characte...
A:
Q: Discuss G1/S phase,
A: The process through which cells multiply into two new cells is known as the cell cycle. G1, S, G2, a...
Q: How is genetic expression regulated?
A: Genetic expression is also known as gene expression. It is the process of the transfer of informati...
Q: The clustered, regularly interspaced short palindromic repeats (CRISPR) system is like a bacterial a...
A:
Q: Analyze the critical parameters to attain higher yield product at the stationary phase during bacter...
A: Stationary phase is stage when growth stops, but cells in this stage remain metabolically active.
Q: The protein based hormones that cannot enter cells is called; O Steroid hormones O Two of these answ...
A: There are few important terms which should kept in mind before answering the above question: We kno...
Q: What is the difference between a food vacuole and a vesicle?
A: A live organism's basic structural and functional unit is the cell. A cell, according to cell theory...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: What are non- LTR retrotransposons ?
A: Non-LTR retrotransposons are the ones that comprise genes coding for reverse transcriptase along wit...
Q: In humans, color vision depends on genes encodingthree pigments. The R (red pigment) and G (green pi...
A: Genetics is a part of science that deals with the investigation of genes, genetic variation, and her...
Q: Which route of administration has 100% bioavailability? O oral intramuscular
A: The different routes of administration are the ways in which a drug can be administered. The oral ro...
Q: Explain comprehensively the secondary growth in dicotyledonous plant stem from the very early stage ...
A: Dicotyledonous Stem The transverse section of a typical young dicotyledonous stem shows that the epi...
Q: Name 3 organs in the human body?
A: As per levels of structural organization of the body , cell is elemental unit of the body and consis...
Q: Component of bilaminar germ disc: a.Hypoblast and endoderm b.Epiblast and hypoblast c.Epiblast and ...
A: INTRODUCTION In the inner cell mass the bilaminar embryonic disc may formed two layers of cell...
Q: List and describe the six functions that proteins provide to cells
A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as ca...
Q: What are the various types of vertebral processes & what is/are the function(s) of each?
A: DISCLAIMER : Since you have asked multiple question, we will solve the first question for you. If yo...
Q: According to the article which was written before the COVID-19 vaccine was created, when do people t...
A:
Q: Which of these is NOT a generally correct statement about bacterial transposons? Transposons...
A: Bacteria are microscopic organisms which is not visible with naked eyes. In our daily bacteria is ca...
Q: Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to ...
A: Replication : it is the process where DNA duplicates Transcription: the process of making an RNA cop...
Q: When using the comparative method (planned comparisons) to study why Violet-throated Starfrontlet (a...
A: Answer : a. A closely related species of starfrontlet that has an unusual haemoglobin protein.
Q: Addition of meat in the diet which contains heme could increase the absorption of iron from plant so...
A: The essential mineral that is required for the purpose of blood production is referred to as iron. I...
Q: On a summer trip to the Galapagos you collect two finch species, Geospiza fortis and G. pauper and b...
A: Geospiza pauper is also known as medium tree finch, categorized under critically endangered.
Q: the patteren of this organ is used to distingiush the whelk from the periwinkle (6 letter word)
A: The periwinkle is the family Gastropoda and vary in size. Snail species live in a variety of habitat...
Q: Which of these is a correct statement about energy-yielding pathways in bacteria? O Anaerobic respir...
A: All pathogens are heterotrophic bacteria that acquire energy from the oxidation of organic molecules...
Q: Can you compare and contrast the infection process of influenza and HIV? What are the specific mole...
A: Virus can be referred to as a genetic material enveloped by a protein coat that can infect and repro...
Q: Connective tissues are somewhat similar to epithelial tissues in all of these characteristics EXCEPT
A: Q 1 Answer: the correct answer to this question is: d.Fibroblasts A fibroblast is the most common t...
Q: How might we reconcile warnings of an impending mass extinction that biodiversity is not systematica...
A: Answer:- Biodiversity loss is caused by five essential drivers: habitat loss, invasive species, ove...
Q: A. B. CH С. O The location marked with the red A. O The location marked with the red B. The location...
A: The genes are the units of heredity of a cell or an organism. The gene is present in the form of tri...
Q: What is one way in which temporal changes in community species composition negatively impact deliver...
A: Our ecosystem has a significant role in sustaining life on the planet. So conservation of its biodiv...
Q: Define about lactose (lac) operon ?
A: The lactose operon also known as the lac operon is a set of genes that are specific for uptake and m...
Q: Which organ of man is homologous to the wings of birds? Justify your answer.
A: Organs apparently similar or dissimilar in structure and function but of similar embryonic origin an...
What are the specific ways in which individuals and environments interact?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
