Genetics MCQ Histones and DNA have a strong attraction for each other because...both are hydrophobicDNA is positively charged and histones are negatively chargedDNA is negatively charged and histones are positively chargedboth have the same charge (like dissolves like)

Histones are proteins that play an important role in the packing of DNA into cells, chromatin, and…

Answered: Histones and DNA have a strong…

Science

Biology

Histones and DNA have a strong attraction for each other because...

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 3SQ: Similarities in ________ are the basis of similarities in traits. a. karyotype b. DNA sequence c....

See similar textbooks

Related questions

Q: What do you mean by DNA polymerase δ?

A: Introduction: DNA polymerase δ is one of the multiple types of DNA polymerases found in eukaryotes.

Q: How does the DNA hold information?

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…

Q: Why is Dna twisted ?

A: The abbreviation of DNA is deoxyribonucleic acid. It is a hereditary genetic material possessing the…

Q: Compare and contrast the DNA and chromosome

A: Inheritance is the process by which this genetic information present in the genes is passed on from…

Q: Each organism ensures the informational fidelity of its DNA in which three important ways?

A: The DNA consists of genes that are the functional and physical unit of inheritance. There are some…

Q: What statement about DNA polarity is TRUE?

A: Two complementary chain of nucleotides makes up DNA. A nucleotide is formed by nitrogenous base,…

Q: Why DNA repair systems is important ?

A: DNA is the genetic material that carries information from parents to offsprings. DNA in a cell can…

Q: Explain the properties of THE DNA?

A: Biomolecules are the compounds that are necessary for different biological processes occurring in a…

Q: People used to think that the genetic code could be found in proteins, because there are so many.…

A: Genetic code It is defined as the set of rules through which the information in the genetic material…

Q: Cells have only one fundamental wayof replicating DNA but many differentways of repairing it. Are…

A: DNA is the genetic material present in the cells of living beings.

Q: Which Strict Operating Requirements DNA Polymerase Has?

A: DNA polymerase is an enzyme involved in the synthesis of nucleotides. These are important for the…

Q: What do you mean by DNA Repair and Recombination?

A: Introduction DNA is highly prone to mutations too which can be either spontaneous or can be caused…

Q: How DNA libraries can be made?

A: A DNA library consists of DNA fragments cloned in vectors that allow researchers to identify the DNA…

Q: As a result of the Human Genome Project, we learned that approximately % of "junk" DNA is actually…

Q: The DNA polymerase cannot start making a new DNA polymer out of nothing, it needs preexisting…

A: DNA molecules makes their own identical copies by a process known as DNA replication. It takes…

Q: How does the DNA stores biological information?

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: How can DNA fragments be separated by size?

A: DNA- Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Explain how DNA stores complex information

A: Information of an individual organism is stored in its DNA molecules. The Same kind of molecules…

Q: DNA is responsible for your phenotype, but to what extent? How much, if at all, do environmental…

A: An organism's phenotype results from two basic factors: the expression of an organism's genes or…

Q: How DNA polymerase is confined ?

A: Replication DNA Replication is a biological process that occurs in all living organisms and copies…

Q: In what ways are DNA polymerase and RNA polymerase similar? How do they differ?

A: DNA and RNA polymerase are enzymes responsible for the synthesis of genetic material that is DNA and…

Q: Can you think of any difference between DNAs and DNase?

A: Genetic information is stored in nucleic acids. There are two types of nucleic acid found in a cell…

Q: TRUE OR FALSE. Non-homologous end-joining as a DNA repair mechanism does not result in loss of…

A: DNA repair is the mechanism by which there is identification and correction of damaged DNA molecules…

Q: Why does every cell in our body contain DNA?

A: DNA is deoxyribonucleic acid which acts as genetic material in all the organisms. It is located in…

Q: The final steps of DNA synthesis involve the removal and replacement of primers with DNA, and the…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Which travels the farthest shorter or larger fragments of DNA? Why?

A: The technique that is used for the separation of DNA based on its size is referred to as gel…

Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are…

A: Deoxyribonucleic acid (DNA) stands for deoxyribonucleic acid. It includes nucleotides, which are…

Q: Name three (3) structural features of the DNA and how they help the DNA perform its functions.

A: The abiotic evolution is also called the chemical evolution. This was the first kind of evolution…

Q: Explain why DNA is structurally stable

A: DNA is genetic material which stores the genetic information of the body.

Q: Comparing your plant (banana) and animal (human) samples, which has more DNA? Take note that DNA is…

A: Chromosomes are characterized as thread-like structures that are present within the nucleus of both…

Q: DNA repair is an important mechanism that protects the genetic material from damage. While working…

A: UV radiation is one of the most widely recognized ecological wellbeing perils that cause…

Q: Uniquely describe the chemical and physical structure of DNA in your own words.

A: DNA or deoxyribonucleic acid which are made up of molecules known as Nucleotides where each…

Q: What is the benefit of this complementary nature of DNA?

A: Complementary strands means that where there is Adenine in one of the stand there would be Thymine…

Q: List Some useful properties of DNA.

A: DNA is deoxyribonucleic acid. It is the hereditary material and is present inside the nucleus of the…

Q: Sequence of _______ in a DNA molecule stores genetic information?

A: Genetic material is stored in the sequence of bases along a nucleic acid chain in DNA. This genetic…

Q: If you eat DNA all the time, why aren’t you harmed by it? What implication does this have on the…

A: DNA or deoxyribonucleic acid is the genetic material found in all cells. It carries the coded…

Q: True or false: The synthesis of a new strand of DNA is initiated using a DNA primer?

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: Muscle cells and neurons have the exact same DNA, however, they look very different and perform…

A: DNA or Deoxyribonucleic acid is a molecule which comprises of two polynucleotide chains that wound…

Q: Why is it incorrect to suggest that DNA duplicates itself?

A: DNA replication is copying a double-stranded DNA molecule to make two identical DNA molecules.…

Q: True or false: During DNA replication, the DNA template is read 3 ́ to 5 ́ by a DNA polymerase, as…

A: DNA replication is a biological process in which two identical copies of DNA are formed during cell…

Q: Why would organisms break down DNA in their surroundings?

A: DNase or deoxyribonuclease refers to an enzyme that is involved in the hydrolytic breaking of the…

Q: How DNA is organized into genes ?

A: Genes are composed of DNA. DNA plays a major role in the formation of proteins. In humans, genes are…

Q: Can you recall the two chemical differences between DNA and RNA?

A: The material used to store genetic information in the mitochondria or nuclei of an organism’s cells…

Q: Do you think DNA deserves all the glory accorded to it as the fundamental unit of the genome?

A: Structure of the DNA is first described by the watson and crick in 1953; by using X ray diffraction…

Q: Why Is DNA Twisted?

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Question

Genetics MCQ

Histones and DNA have a strong attraction for each other because...
both are hydrophobic
DNA is positively charged and histones are negatively charged
DNA is negatively charged and histones are positively charged
both have the same charge (like dissolves like)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The DNA double helix looks like a twisted ladder.What makes up each rung of the ladder, what holds the rungs of the ladder and what holds the rungs together at the sides? Explain the reason for this orientation.
Make up your own DNA palindrome, of at least 6 bases long. Make sure it is palindromic in the correct way (hint: you need to consider both strands!)
Comparing your plant (banana) and animal (human) samples, which has more DNA? Take note that DNA is carried on chromosomes, relate your explanation with how many chromosomes each sample carries.
About how many nucleosomes could be made from a DNA strand consisting of 1000 B-helical turns? A. 5B. 50C. 500D. This is not enough DNA to make even one nucleosome
Similarities in ________ are the basis of similarities in traits. a. karyotype b. DNA sequence c. the double helix d. chromosome number
Select all of the statements that correctly describe DNA structure: Base pairing will always be between a purine base and a pyrimidine base. Two connected DNA strands will be oriented in the same direction. Hydrogen bonds will hold two DNA strands together. The sugars and phosphate groups are located on the exterior of the helix. The pyrimidine and purine bases are located on the outside of the double helix.
Build a 3D model of a DNA molecule:-3-dimensional built structure -Contain sugar-phosphate backbones (constructed as separate molecules) -Contain nitrogenous bases (paired clearly and correctly) -Have a minimum of 10 base-pairs (minimum of 10 “rungs” or “steps” on the ladder) with the correct number of hydrogen bonds illustrated between each of the base pairs. -Have the orientation labeled on each strand and make sure the two strands are antiparallel.
Which does NOT apply to most bacterial DNA ? -Relaxed -Not packed into nucleosomes -Circular -Super-coiled
Please explain it simply, and don't over-explain. Thanks! A. How is DNA structure arranged to allow it to do its function?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Describe the structure of DNA. The two strands of DNA are antiparallel. What does the term antiparallel mean? Describe how DNA is tightly packaged. Your description should include the terms histones, chromatin, nucleosomes and chromosomes.
When DNA is heated sufficiently, the strands separate. The energy that it takes to separate the DNA is related to the amount of guanine and cytosine bases. Why is this so? (A) Adenine and thymine make 3 hydrogen bonds between each other, and guanine and cytosine don't make any hydrogen bonds. (B) Guanine and cytosine make 3 hydrogen bonds between each other, and adenine and thymine don't make any hydrogen bonds. (C) It takes more energy to break an A-T bond than it does a G-C bond. (D) It takes more energy to break a G-C bond than it does an A-T bond.