Q: Explain how in some cases a single nucleotide change in a DNA sequence can have very detrimental…
A: Mutations is the sudden heritable change in the make up of gene. Mutation basically occur by…
Q: Okazaki fragments are short DNA pieces that explain how
A:
Q: If the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell…
A: DNA packaging is done in order to fit the linear DNA molecule inside the nucleus. Is starts when DNA…
Q: explains how the underwinding of a B-DNA helix might facilitate or stabilize the formation of Z-DNA
A: Dideoxy ribonucleic acid (DNA), ribonucleic acid (RNA), and proteins play an essential role in the…
Q: When UV light strikes DNA at a location where two thymines are side by side, what happens?
A: UV stands for ultraviolet rays. It causes a mutation in the DNA.
Q: DNA molecules of different sizes are often separated with the use of a technique called…
A: Electrophoresis is a technique that is used to separate molecules based on their sizes.
Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…
A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…
Q: The DNA of a skin sell and a muscle cell are identical. But the skin cell may contain the proteins…
A: DNA (Deoxyribonucleic acid) is a double helical structure present in nucleus of a cell and contains…
Q: Why does Valerie's blood from her peripheral, tumor and breast samples all show bands of DNA that…
A: Many risk factors for cancer have been identified, including exposure to certain carcinogens in our…
Q: (b) How many forms can naturally occurring DNA exist in? Explain how these forms are characterized.…
A: DNA Deoxyribonucleic acid Genetic material in many species Has ds(double stranded) structure…
Q: After death, muscles become very stiff, a condition known as rigor mortis. Explain the molecular…
A: Anatomy and physiology are the branches of biology, anatomy deals with the study of the structure of…
Q: Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA…
A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…
Q: Please explain the full DNA synthesis process
A: DNA synthesis occurs when a cell divides, in the process known as replication. DNA replication is…
Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…
A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…
Q: 3b) During DNA replication, one new DNA strand is synthesized continuously but the other strand is…
A: DNA is a long polymer of nucleotides which makes the genetic material of most of the living organism…
Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…
A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors, The…
Q: Histones and DNA have a strong attraction for each other because...
A: Histones are proteins that play an important role in the packing of DNA into cells, chromatin, and…
Q: Although human DNA has a total length of 2 m, it is packaged into a nucleus that is 5 µm in…
A: Cells wrap their DNA strands around scaffolding proteins to form chromatin, a coiled compact…
Q: Explain how the structure of DNA enables the molecule to be easily transcribed. Why is this…
A: DNA has a primary structure of double stranded helix with the building blocks as nucleotides. The…
Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: unfold the protein
A: Protein are consist of polymers of amino acids linked by amide/peptide bonds, which is called as…
Q: Adjacent pyrimidine bases in DNA form dimers with high efficiency after exposure to UV light. If…
A: Skin tanning is the process in which the skin color is darkened as a result of exposure to…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?
A: DNA chip used in microarray
Q: draw the structure of telomeres
A: Telomeres are a region of repetitive nucleotide sequences found at each end on a eukaryotic…
Q: The difference between ATP and the nucleoside triphosphates used during DNA synthesis is that
A: ATP is known as the energy currency of the living world. It contains three phosphates attached to…
Q: List three mechanisms that relax the twisting stress in helical DNA molecules.
A: The Structure of deoxyribonucleic acidREFLECT AND APPLY List 3 mechanisms that relax the twisting…
Q: During DNA replication, each new strand of DNA is synthesized from both ends at once. This statement…
A: DNA Is the basic unit of inheritance. DNA undergoes replication, transcription, translation, etc for…
Q: During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA.…
A: The process of making copies of the DNA during cell division is called DNA replication. The genetic…
Q: When chromatin is treated with non-specific nucleases, what is the length of the resulting pieces of…
A: Nucleases are the enzymes that digest the nucleic acids.
Q: Expressed sequences of DNA are called ________________.
A: DNA or deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around…
Q: How might the underwinding of a B-DNA helix facilitate or stabilize the formation of Z-DNA? Strands…
A: The B-DNA is the most relaxed form of DNA. Other forms of DNA that exist on nature are A-DNA, C-DNA,…
Q: DNA repair is an important mechanism that protects the genetic material from damage. While working…
A: UV radiation is one of the most widely recognized ecological wellbeing perils that cause…
Q: In the DNA of what kind of cell must a mutation occur for the genetic change to be passed down to…
A: Mutation is any kind of change in the gene sequence of the DNA which may ultimately affect the…
Q: How many times wider is a 30 nm fiber than a DNA double helix? Show your work.
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…
A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…
Q: Describe the movement of the open complex along the DNA.
A: The open complex is used in the process of transcription when the DNA template is used to produce…
Q: Cells with more telomere repeats are able to withstand more rounds of DNA replication True or False
A: Telomeres --Telomeres are the region of repetitive nucleotide sequences and physical ends of…
Q: Calculate the length of the 50,000-bp DNA in a 30-nm fiber.
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that coil around…
Q: Briefly explain why DNA replication produces two daughter strands that are identical to each other…
A: The biochemical process that involves the synthesis of a new DNA molecule of the mirror image on a…
Q: Additional twisting of DNA upon itself is called ____________ The enzyme that can relax or remove…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: Explain how DNA gyrase works.
A: DNA replication is the biological method of creating two identical replicas of DNA from a single…
Q: The drug Ciprofloxacin hydrochloride (Cipro) blocks bacterial DNA gyrase enzyme needed to counteract…
A: Ciprofloxacin is a generic antibiotic that the Food and Drug Administration (FDA) has recommended…
Q: Complementary strand for A T C and G
A: There are two types of nucleotide bases in DNA - Purines - A(Adenine) and G(Guanine) Pyrimidines -…
Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…
A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…
Q: If DNA segments changes from GCATAG to GCATA, this is a:
A: Mutation is a sudden, stable, and variable change in the genome of an organism. It may be due to…
Q: True or false: During DNA replication, the DNA template is read 3 ́ to 5 ́ by a DNA polymerase, as…
A: DNA replication is a biological process in which two identical copies of DNA are formed during cell…
Step by step
Solved in 3 steps
- Briefly explain why DNA replication produces two daughter strands that are identical to each other and to the parent DNA.During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA. What are these 3 proteins and is there an helpful way that can I remember what each of thier functions are?The DNA of a skin sell and a muscle cell are identical. But the skin cell may contain the proteins collagen and keratin in high amount, which the muscle lacks (or has very little of), while the muscle cell may have large amounts of the proteins actin and myosin, which the skin cell lacks (or has very little of). Explain this apparent contradiction.
- Additional twisting of DNA upon itself is called ____________ The enzyme that can relax or remove this phenomenon is called ________________How important and useful to the cell is the ability of the DNA to assume various forms? Why are these various forms necessary?List three mechanisms that relax the twisting stress in helical DNA molecules.
- DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?explain DNA transposons: Structure and movementDuring DNA replication, each new strand of DNA is synthesized from both ends at once. This statement is false. why is this false?
- The double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?the human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During infection, however, HIV uses an enzyme known as reverse transcriptase to generate double-stranded DNA. Generally speaking, how would the enzyme generate a double strand of DNA from a single strand of RNA?DNA repair enzymes that correct deamination and depurination must preferentially recognize these defects on newly synthesized strands. Explain in 1-2 sentences.